Ectopic expression of an expansin-like B gene from wild Arachis enhances tolerance to both abiotic and biotic stresses

Oligodendrocytes kind myelin sheaths that encompass axons, contributing to saltatory conduction and correct central nervous system (CNS) operate. Oligodendrocyte progenitor cells (OPCs) are generated in the course of the embryonic stage and differentiate into myelinating oligodendrocytes postnatally. Ddx20 is a multifunctional, DEAD-box helicase concerned in a number of mobile processes, together with transcription, splicing, microRNA biogenesis, and translation.

Although defects in every of these processes lead to irregular oligodendrocyte differentiation and myelination, the involvement of Ddx20 in oligodendrocyte terminal differentiation stays unknown. To tackle this query, we used Mbp-Cre mice to generate Ddx20 conditional knockout (cKO) mice to permit for the deletion of Ddx20 from mature oligodendrocytes. Mbp-Cre;Ddx20 cKO mice demonstrated small physique sizes, behavioral abnormalities, muscle weak point, and quick lifespans, with mortality by the age of 2 months outdated.

Histological analyses demonstrated vital reductions within the quantity of mature oligodendrocytes and drastic reductions within the expression ranges of myelin-associated mRNAs, similar to Mbp and Plp at postnatal day 42. The quantity of OPCs didn’t change. A skinny myelin layer was noticed for large-diameter axons in Ddx20 cKO mice, based mostly on electron microscopic evaluation.

A bromodeoxyuridine (BrdU) labeling experiment demonstrated that terminal differentiation was perturbed from ages 2 weeks to 7 weeks within the CNS of Mbp-Cre;Ddx20 cKO mice. The activation of mitogen-activated protein (MAP) kinase, which promotes myelination, was downregulated within the Ddx20 cKO mice based mostly on immunohistochemical detection. These outcomes point out that Ddx20 is an important issue for terminal differentiation of oligodendrocytes and upkeep of myelin gene expression.

By amassing a number of units per topic in microarray information, gene units evaluation requires characterize intra-subject variation utilizing gene expression profiling. For every topic, the info might be written as a matrix with the totally different subsets of gene expressions (e.g. a number of tumor varieties) indexing the rows and the genes indexing the columns.

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit
RDR-FYN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit
RDR-FYN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit
RDR-FYN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit
RDR-FYN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit
RD-FYN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit
RD-FYN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit
RD-FYN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit
RD-FYN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

HEK-293T Telomerase Over-Expressing Cell Pellet
abx069991-1Pellet	Abbexa	1 Pellet	EUR 398
Shipped within 1-3 working days.

Fyn/ Rat Fyn ELISA Kit
ELI-09878r	Lifescience Market	96 Tests	EUR 886

Chymase reagent
30C-CP1129	Fitzgerald	5 units	EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent
2330-1000	Biovision		EUR 349

Traut's Reagent
2330-500	Biovision		EUR 207

MTS Reagent
2808-1000	Biovision		EUR 990

MTS Reagent
2808-250	Biovision		EUR 365

MTT Reagent
2809-1G	Biovision		EUR 180

MTT Reagent
2809-5G	Biovision		EUR 544

BOP reagent
5-02141	CHI Scientific	25g	Ask for price

BOP reagent
5-02142	CHI Scientific	100g	Ask for price

Bluing Reagent
BRT030	ScyTek Laboratories	30 ml	EUR 60

Bluing Reagent
BRT125	ScyTek Laboratories	125 ml	EUR 63

Bluing Reagent
BRT3800	ScyTek Laboratories	1 Gal.	EUR 184

Bluing Reagent
BRT500	ScyTek Laboratories	500 ml	EUR 76

Bluing Reagent
BRT999	ScyTek Laboratories	1000 ml	EUR 88

BOP reagent
A7015-100000	ApexBio	100 g	EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent
A7015-25000	ApexBio	25 g	EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent
HY-100951	MedChemExpress	10mM/1mL	EUR 126

Bradford reagent
BDE641	Bio Basic	100ml	EUR 61.01
Product category: Biochemicals/Biology Reagents/Protein Related

FYN antibody
70R-31289	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FYN antibody

FYN antibody
10R-10608	Fitzgerald	100 ug	EUR 349
Description: Mouse monoclonal FYN antibody

FYN antibody
10R-11001	Fitzgerald	100 ug	EUR 349
Description: Mouse monoclonal FYN antibody

FYN Antibody
43186-100ul	SAB	100ul	EUR 252

FYN Antibody
1-CSB-PA002595	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FYN. Recognizes FYN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

FYN Antibody
1-CSB-PA143385	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FYN. Recognizes FYN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FYN Antibody
1-CSB-PA225018	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FYN. Recognizes FYN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FYN antibody
70R-49768	Fitzgerald	100 ul	EUR 287
Description: Purified Polyclonal FYN antibody

FYN antibody
70R-5772	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FYN antibody raised against the N terminal of FYN

FYN antibody
70R-5867	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FYN antibody raised against the middle region of FYN

Fyn Antibody
AF6102	Affbiotech	200ul	EUR 304
Description: Fyn Antibody detects endogenous levels of total Fyn.

FYN Antibody
BF0309	Affbiotech	200ul	EUR 376
Description: FYN antibody detects endogenous levels of total FYN.

FYN Antibody
1-CSB-PA009101LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FYN. Recognizes FYN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

FYN Antibody
1-CSB-PA008520	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FYN. Recognizes FYN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

FYN siRNA
20-abx902045	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FYN siRNA
20-abx917352	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FYN siRNA
20-abx917353	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Fyn Antibody
AF7697	Affbiotech	200ul	EUR 376
Description: Fyn Antibody detects endogenous levels of Fyn.

Fyn Antibody
ABF6102	Lifescience Market	100 ug	EUR 438

anti-Fyn
YF-PA11887	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Fyn

anti-Fyn
YF-PA11888	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Fyn

anti-Fyn
YF-PA23745	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Fyn

anti-Fyn
YF-PA23746	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Fyn

Monoclonal SYN / FYN Antibody (aa7-176, clone FYN-59), Clone: FYN-59
AMM01704G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human SYN / FYN (aa7-176, clone FYN-59). The antibodies are raised in Mouse and are from clone FYN-59. This antibody is applicable in WB and IHC-P, IP

Monoclonal SYN / FYN Antibody (aa7-176, clone FYN-01), Clone: FYN-01
AMM01732G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human SYN / FYN (aa7-176, clone FYN-01). The antibodies are raised in Mouse and are from clone FYN-01. This antibody is applicable in WB and IHC-P, ICC, IP

Arabidopsis Thaliana Lysate
30R-AA023	Fitzgerald	150 ug	EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate
35-1867	Fitzgerald	1 mg	EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate
35-1872	Fitzgerald	1 ml	EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate
35-1873	Fitzgerald	1 ml	EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody
abx234439-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

BL21-lysate Antibody
abx230905-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DH5a-lysate Antibody
abx232362-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Green Algae Lysate
PABL-1306	Alpha Diagnostics	50 ug	EUR 164

Rat Tyrosine protein kinase Fyn(FYN) ELISA kit
E02T0613-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tyrosine protein kinase Fyn(FYN) ELISA kit
E02T0613-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tyrosine protein kinase Fyn(FYN) ELISA kit
E02T0613-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Fyn(FYN) ELISA kit
E04T0613-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Fyn(FYN) ELISA kit
E04T0613-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Fyn(FYN) ELISA kit
E04T0613-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine protein kinase Fyn(FYN) ELISA kit
E01T0613-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine protein kinase Fyn(FYN) ELISA kit
E01T0613-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine protein kinase Fyn(FYN) ELISA kit
E01T0613-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tyrosine protein kinase Fyn(FYN) ELISA kit
E03T0613-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tyrosine protein kinase Fyn(FYN) ELISA kit
E03T0613-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tyrosine protein kinase Fyn(FYN) ELISA kit
E03T0613-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tyrosine-Protein Kinase Fyn (FYN) ELISA Kit
20-abx154045	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tyrosine-Protein Kinase Fyn (FYN) ELISA Kit
20-abx151604	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Dog Tyrosine protein kinase Fyn(FYN) ELISA kit
E08T0613-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tyrosine protein kinase Fyn(FYN) ELISA kit
E08T0613-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tyrosine protein kinase Fyn(FYN) ELISA kit
E08T0613-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tyrosine protein kinase Fyn(FYN) ELISA kit
E07T0613-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tyrosine protein kinase Fyn(FYN) ELISA kit
E07T0613-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tyrosine protein kinase Fyn(FYN) ELISA kit
E07T0613-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tyrosine protein kinase Fyn(FYN) ELISA kit
E09T0613-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tyrosine protein kinase Fyn(FYN) ELISA kit
E09T0613-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tyrosine protein kinase Fyn(FYN) ELISA kit
E09T0613-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tyrosine protein kinase Fyn(FYN) ELISA kit
E06T0613-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tyrosine protein kinase Fyn(FYN) ELISA kit
E06T0613-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tyrosine protein kinase Fyn(FYN) ELISA kit
E06T0613-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Tyrosine- protein kinase Fyn, FYN ELISA KIT
ELI-30932b	Lifescience Market	96 Tests	EUR 928

Chicken Tyrosine- protein kinase Fyn, FYN ELISA KIT
ELI-27562c	Lifescience Market	96 Tests	EUR 928

Human Tyrosine- protein kinase Fyn, FYN ELISA KIT
ELI-27563h	Lifescience Market	96 Tests	EUR 824

Rat Tyrosine-Protein Kinase Fyn (FYN) ELISA Kit
abx391361-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Tyrosine- protein kinase Fyn, Fyn ELISA KIT
ELI-37594m	Lifescience Market	96 Tests	EUR 865

Porcine Tyrosine- protein kinase Fyn, FYN ELISA KIT
ELI-47364p	Lifescience Market	96 Tests	EUR 928

BSA (Reagent Grade)
30-AB79	Fitzgerald	1 kg	EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)
30-AB81	Fitzgerald	200 grams	EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit
30100	Biotium	1KIT	EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent
2594-1	Biovision		EUR 207

BODIPY-Acetylene Reagent
2594-5	Biovision		EUR 675

Biotin reagent (HRP)
65C-CE0202	Fitzgerald	5 mg	EUR 244
Description: HRP conjugated biotin labelling reagent

Convoy? Transfection Reagent
1110-1ml	ACTGene		EUR 341

Bradford Dye Reagent
0209R	AthenaES	100 ml	EUR 131

HAMA blocking reagent
85R-1001	Fitzgerald	1 gram	EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent
85R-1001P	Fitzgerald	1 gram	EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent
85R-1003	Fitzgerald	1 gram	EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent
85R-1014	Fitzgerald	50 mg	EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent
85R-1025	Fitzgerald	50 mg	EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent
85R-1026	Fitzgerald	50 mg	EUR 192
Description: HAMA blocking reagent for use in immunoassays

Girard's reagent T
20-abx184099	Abbexa	EUR 203.00 EUR 314.00	100 g 500 g
Shipped within 1-2 weeks.

EL Transfection Reagent
20-abx098880	Abbexa	EUR 384.00 EUR 537.00	0.75 ml 1.5 ml
Shipped within 5-10 working days.

Mycoplasma Prevention Reagent
20-abx098886	Abbexa	EUR 425.00 EUR 509.00	1 ml 5 ml
Shipped within 5-10 working days.

Alcohol, Reagent (70%)
EAS500	ScyTek Laboratories	500 ml	EUR 79

Alcohol, Reagent (70%)
EAS999	ScyTek Laboratories	1000 ml	EUR 101

BCA Reagent, 16ML
C144-16ML	Arbor Assays	16ML	EUR 163

Biolipidure-1002-Reagent
Biolipidure-1002-10	Cusabio	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent
Biolipidure-1002-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent
Biolipidure-103-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent
Biolipidure-103-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent
Biolipidure-1201-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent
Biolipidure-1201-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent
Biolipidure-1301-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent
Biolipidure-1301-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent
Biolipidure-203-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent
Biolipidure-203-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent
Biolipidure-206-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent
Biolipidure-206-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent
Biolipidure-405-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent
Biolipidure-405-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent
Biolipidure-502-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent
Biolipidure-502-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent
Biolipidure-702-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent
Biolipidure-702-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent
Biolipidure-802-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent
Biolipidure-802-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

FcR blocking Reagent
20-abx290024	Abbexa	EUR 377.00 EUR 516.00	200 tests 400 tests
Shipped within 2-3 weeks.

Detection Reagent A
abx296004-120ul	Abbexa	120 ul	EUR 321
Shipped within 5-10 working days.

Mycoplasma Prevention Reagent
20-abx298005	Abbexa	EUR 203.00 EUR 286.00	1 ml 5 ml
Shipped within 5-10 working days.

PhosphoBlocker Blocking Reagent
AKR-103	Cell Biolabs	1L	EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent
AKR-104	Cell Biolabs	4L	EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Tri-RNA Reagent
FATRR-001	Favorgen	100ml	EUR 236

Tri-RNA Reagent
FATRR-002	Favorgen	50ml	EUR 176

Tri-RNA Reagent
FATRR-003	Favorgen	450ml	EUR 645

LP4K Transfection Reagent
LP4K	GenTarget	1.0 ml / vial	EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

PureFection Transfection Reagent
LV750A-1	SBI	1 ml	EUR 359
Category: Lentiviral Technology

HighGene transfection reagent
RM09014	Abclonal	1000μl	EUR 270

TissueDigest Reagent, 20X
T101	Insitus Biotechnologies	10ml	EUR 210

ExFect2000 Transfection Reagent
T202-01	Vazyme	0.5 ml	EUR 227

ExFect2000 Transfection Reagent
T202-02	Vazyme	1 ml	EUR 316

ExFect2000 Transfection Reagent
T202-03	Vazyme	5 ml	EUR 1052

Dissociation Reagent, 1ML
X017-1ML	Arbor Assays	1ML	EUR 109

Dissociation Reagent, 25ML
X017-25ML	Arbor Assays	25ML	EUR 258

Dissociation Reagent, 5ML
X017-5ML	Arbor Assays	5ML	EUR 122

Dissociation Reagent, 1ML
X058-1ML	Arbor Assays	1ML	EUR 73

Dissociation Reagent, 5ML
X058-5ML	Arbor Assays	5ML	EUR 109

DTT (Cleland's reagent)
DB0058	Bio Basic	5g	EUR 84.8
Product category: Electrophoresis Related/Reducing Agents

DTNB (Ellman's Reagent)
DB0113	Bio Basic	5g	EUR 97.85
Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Ethyl acetate Reagent
EC4600	Bio Basic	1L	EUR 79
Product category: Biochemicals/Solvents

n-Heptane Reagent
HC5400	Bio Basic	1L	EUR 79
Product category: Biochemicals/Solvents

FYN antibody (Tyr530)
70R-31288	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal FYN antibody (Tyr530)

FYN Blocking Peptide
33R-3193	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FYN antibody, catalog no. 70R-5772

FYN Blocking Peptide
33R-1771	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FYN antibody, catalog no. 70R-5867

Anti-FYN Purified
11-375-C025	ExBio	0.025 mg	EUR 122

Anti-FYN Purified
11-375-C100	ExBio	0.1 mg	EUR 204

Fyn Polyclonal Antibody
40943-100ul	SAB	100ul	EUR 252

Fyn Polyclonal Antibody
40943-50ul	SAB	50ul	EUR 187

FYN Mouse mAb
A0086-100ul	Abclonal	100 ul	EUR 384

FYN Mouse mAb
A0086-200ul	Abclonal	200 ul	EUR 554

FYN Mouse mAb
A0086-20ul	Abclonal	20 ul	Ask for price

FYN Mouse mAb
A0086-50ul	Abclonal	50 ul	EUR 265

Fyn antibody (Tyr530)
70R-37433	Fitzgerald	100 ug	EUR 349
Description: Rabbit Polyclonal Fyn antibody (Tyr530)

FYN (pT530) Antibody
20-abx009886	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

FYN (pS21) Antibody
20-abx123287	Abbexa	EUR 495.00 EUR 704.00 EUR 217.00 EUR 356.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

FYN (pY416) Antibody
20-abx123288	Abbexa	EUR 495.00 EUR 704.00 EUR 217.00 EUR 356.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fyn (pY530) Antibody
abx010767-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Fyn-p59 Protein
20-abx263558	Abbexa	EUR 829.00 EUR 411.00 EUR 537.00	10 ug 2 µg 5 ug
Shipped within 5-10 working days.

Fyn Blocking Peptide
AF6102-BP	Affbiotech	1mg	EUR 195

FYN Conjugated Antibody
C43186	SAB	100ul	EUR 397

FYN Blocking Peptide
BF0309-BP	Affbiotech	1mg	EUR 195

FYN (pY530) Antibody
abx333497-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Fyn Blocking Peptide
AF7697-BP	Affbiotech	1mg	EUR 195

Monoclonal Fyn Antibody
AMM03159G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human Fyn. The antibodies are raised in Mouse. This antibody is applicable in WB, ICC

FYN cloning plasmid
CSB-CL009101HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1449 Sequence: atgggctgtgtgcaatgtaaggataaagaagcaacaaaactgacggaggagagggacggcagcctgaaccagagctctgggtaccgctatggcacagaccccacccctcagcactaccccagcttcggtgtgacctccatccccaactacaacaacttccacgcagccgggggcc Show more
Description: A cloning plasmid for the FYN gene.

Fyn Polyclonal Antibody
ABP54417-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213 Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213

Fyn Polyclonal Antibody
ABP54417-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213 Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213

Fyn Polyclonal Antibody
ABP54417-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213 Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213

Fyn Polyclonal Antibody
ABP51383-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530 Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530

Fyn Polyclonal Antibody
ABP51383-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530 Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530

Fyn Polyclonal Antibody
ABP51383-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530 Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530

FYN Polyclonal Antibody
A59178	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

To check the belief of intra-subject (tumor) variation, we current and carry out exams of multi-set sphericity and multi-set identification of covariance buildings throughout topics (tumor varieties). We display by both theoretical and empirical research that the exams have good properties. We utilized the proposed exams on The Cancer Genome Atlas (TCGA) and examined covariance buildings for the gene expressions throughout a number of tumor varieties.