Hudsen

Human brain gene expression atlas project

Human AOAH(Acyloxyacyl Hydrolase) ELISA Kit

Human AOAH(Acyloxyacyl Hydrolase) ELISA Kit

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RD-AOAH-Hu-96Tests 96 Tests
EUR 723

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RDR-AOAH-Hu-48Tests 48 Tests
EUR 544

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
RDR-AOAH-Hu-96Tests 96 Tests
EUR 756

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
E01A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acyloxyacyl hydrolase, AOAH ELISA KIT
ELI-34429h 96 Tests
EUR 824

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
20-abx150541
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Acyloxyacyl Hydrolase (AOAH)ELISA Kit
201-12-2818 96 tests
EUR 440
  • This Acyloxyacyl Hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
CSB-EL001853HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Acyloxyacyl hydrolase(AOAH) ELISA kit
1-CSB-EL001853HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Acyloxyacyl Hydrolase(AOAH)ELISA Kit
QY-E00892 96T
EUR 361

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
SEJ634Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit
4-SEJ634Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Acyloxyacyl Hydrolase elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Acyloxyacyl Hydrolase (AOAH) Antibody
20-abx125520
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Acyloxyacyl Hydrolase (AOAH) Antibody
20-abx128358
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Acyloxyacyl Hydrolase (AOAH) Antibody
20-abx171073
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Acyloxyacyl Hydrolase (AOAH) Antibody
20-abx148216
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acyloxyacyl Hydrolase (AOAH) Antibody
abx029449-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Acyloxyacyl Hydrolase (AOAH) Antibody
abx029449-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Acyloxyacyl Hydrolase (AOAH) Antibody
20-abx318749
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acyloxyacyl Hydrolase (AOAH) Antibody
abx230453-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Acyloxyacyl Hydrolase (AOAH)
4-RPJ634Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P28039
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Acyloxyacyl Hydrolase expressed in: E.coli

Goat Acyloxyacyl hydrolase(AOAH) ELISA kit
E06A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acyloxyacyl hydrolase(AOAH) ELISA kit
E06A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acyloxyacyl hydrolase(AOAH) ELISA kit
E06A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acyloxyacyl hydrolase(AOAH) ELISA kit
E02A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acyloxyacyl hydrolase(AOAH) ELISA kit
E02A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acyloxyacyl hydrolase(AOAH) ELISA kit
E02A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit
E03A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit
E03A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit
E03A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyloxyacyl hydrolase(AOAH) ELISA kit
E04A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyloxyacyl hydrolase(AOAH) ELISA kit
E04A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acyloxyacyl hydrolase(AOAH) ELISA kit
E04A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acyloxyacyl hydrolase(AOAH) ELISA kit
E07A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acyloxyacyl hydrolase(AOAH) ELISA kit
E07A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acyloxyacyl hydrolase(AOAH) ELISA kit
E07A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acyloxyacyl hydrolase(AOAH) ELISA kit
E09A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acyloxyacyl hydrolase(AOAH) ELISA kit
E09A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acyloxyacyl hydrolase(AOAH) ELISA kit
E09A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acyloxyacyl hydrolase(AOAH) ELISA kit
E08A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acyloxyacyl hydrolase(AOAH) ELISA kit
E08A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acyloxyacyl hydrolase(AOAH) ELISA kit
E08A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acyloxyacyl hydrolase, Aoah ELISA KIT
ELI-24219m 96 Tests
EUR 865

Rabbit Acyloxyacyl hydrolase, AOAH ELISA KIT
ELI-49571Ra 96 Tests
EUR 928

Mouse Acyloxyacyl hydrolase (AOAH) ELISA Kit
abx388507-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit
CSB-EL001853MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Acyloxyacyl hydrolase(AOAH) ELISA kit
1-CSB-EL001853MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Acyloxyacyl Hydrolase (AOAH) Protein
20-abx166775
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Acyloxyacyl Hydrolase (AOAH) CLIA Kit
20-abx495751
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human AOAH (Acyloxyacyl Hydrolase)
ELK3978 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Acyloxyacyl Hydrolase (AOAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Acylo
  • Show more
Description: A sandwich ELISA kit for detection of Acyloxyacyl Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Acyloxyacyl Hydrolase (AOAH) Antibody (HRP)
20-abx315584
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acyloxyacyl Hydrolase (AOAH) Antibody (FITC)
20-abx315585
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Acyloxyacyl Hydrolase (AOAH) Antibody (Biotin)
20-abx315586
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea pig Acyloxyacyl hydrolase(AOAH) ELISA kit
E05A1552-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Acyloxyacyl hydrolase(AOAH) ELISA kit
E05A1552-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Acyloxyacyl hydrolase(AOAH) ELISA kit
E05A1552-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Aoah ELISA Kit| Mouse Acyloxyacyl hydrolase ELISA Kit
EF014132 96 Tests
EUR 689

Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig)
4-PAJ634Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AOAH (Ser24~Gln300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH)

Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), APC
4-PAJ634Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AOAH (Ser24~Gln300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with APC.

Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAJ634Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AOAH (Ser24~Gln300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with Biotin.

Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), Cy3
4-PAJ634Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AOAH (Ser24~Gln300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with Cy3.

Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), FITC
4-PAJ634Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AOAH (Ser24~Gln300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with FITC.

Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), HRP
4-PAJ634Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AOAH (Ser24~Gln300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with HRP.

Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), PE
4-PAJ634Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AOAH (Ser24~Gln300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with PE.

Acyloxyacyl Hydrolase (AOAH) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAJ634Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AOAH (Ser24~Gln300)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Acyloxyacyl Hydrolase (AOAH). This antibody is labeled with APC-Cy7.

anti-Acyloxyacyl Hydrolase
YF-PA10235 50 ug
EUR 363
Description: Mouse polyclonal to Acyloxyacyl Hydrolase

AOAH ELISA KIT|Human
EF007800 96 Tests
EUR 689

AOAH ELISA Kit (Human) (OKCD00573)
OKCD00573 96 Wells
EUR 831
Description: Description of target: Removes the secondary (acyloxyacyl-linked) fatty acyl chains from the lipid A region of bacterial lipopolysaccharides. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

AOAH ELISA Kit (Human) (OKDD00125)
OKDD00125 96 Wells
EUR 975
Description: Description of target: This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript variants have been described.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.059 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

AOAH siRNA
20-abx907683
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AOAH siRNA
20-abx907684
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AOAH Antibody
ABD9158 100 ug
EUR 438

AOAH Antibody
45747-100ul 100ul
EUR 252

AOAH Antibody
45747-50ul 50ul
EUR 187

AOAH Antibody
46930-100ul 100ul
EUR 252

AOAH Antibody
DF9158 200ul
EUR 304
Description: AOAH Antibody detects endogenous levels of total AOAH.

AOAH Antibody
1-CSB-PA001853LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOAH. Recognizes AOAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

pENTR223-AOAH
PVT12261 2 ug
EUR 391

Human AOAH shRNA Plasmid
20-abx950215
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AOAH Recombinant Protein (Human)
RP001396 100 ug Ask for price

AOAH Conjugated Antibody
C45747 100ul
EUR 397

AOAH Conjugated Antibody
C46930 100ul
EUR 397

anti- AOAH antibody
FNab00453 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: acyloxyacyl hydrolase(neutrophil)
  • Uniprot ID: P28039
  • Gene ID: 313
  • Research Area: Metabolism
Description: Antibody raised against AOAH

AOAH Polyclonal Antibody
ES9349-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AOAH from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AOAH Polyclonal Antibody
ES9349-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AOAH from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AOAH Polyclonal Antibody
ABP57779-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of AOAH from Human, Mouse. This AOAH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340

AOAH Polyclonal Antibody
ABP57779-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of AOAH from Human, Mouse. This AOAH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340

AOAH Polyclonal Antibody
ABP57779-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340
  • Applications tips:
Description: A polyclonal antibody for detection of AOAH from Human, Mouse. This AOAH antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AOAH protein at amino acid sequence of 260-340

AOAH Rabbit pAb
A10366-100ul 100 ul
EUR 308

AOAH Rabbit pAb
A10366-200ul 200 ul
EUR 459

AOAH Rabbit pAb
A10366-20ul 20 ul
EUR 183

AOAH Rabbit pAb
A10366-50ul 50 ul
EUR 223

AOAH Blocking Peptide
DF9158-BP 1mg
EUR 195

AOAH cloning plasmid
CSB-CL001853HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1728
  • Sequence: atgcagtccccctggaaaatccttacggtggcgcctctattcttgctcctgtctcttcagtcctcagcctctccagccaacgatgaccagtccaggcccagcctctcgaatgggcacacctgtgtagggtgtgtgctggtggtgtctgtaatagaacagcttgctcaagttcaca
  • Show more
Description: A cloning plasmid for the AOAH gene.

Anti-AOAH antibody
PAab00453 100 ug
EUR 355

Anti-AOAH antibody
STJ112403 100 µl
EUR 277
Description: This locus encodes both the light and heavy subunits of acyloxyacyl hydrolase. The encoded enzyme catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides, effectively detoxifying these molecules. The encoded protein may play a role in modulating host inflammatory response to gram-negative bacteria. Alternatively spliced transcript variants have been described.

Anti-AOAH antibody
STJ190507 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AOAH

Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bleomycin hydrolase(BLMH) ELISA kit
E01B0805-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit
E01G0559-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit
E01G0559-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human γ Glutamate Hydrolase ELISA kit
E01G0559-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit
E01H0015-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human HAGH(Hydroxyacylglutathione Hydrolase) ELISA Kit
EH3210 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q16775
  • Alias: HAGH/GLX2/HAGH/GLO2hydroxyacyl glutathione hydrolase/Glx II/GLXII/Glyoxalase II/HAGH1GLX2/hydroxyacylglutathione hydrolase/hydroxyacylglutathione hydrolase, mitochondrial/hydroxyacylglutathion
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Valacyclovir hydrolase, BPHL ELISA KIT
ELI-11153h 96 Tests
EUR 824

Human Bleomycin hydrolase, BLMH ELISA KIT
ELI-50039h 96 Tests
EUR 824

Human Bleomycin Hydrolase (BLMH) ELISA Kit
20-abx150813
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
20-abx151482
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Valacyclovir Hydrolase (BPHL) ELISA Kit
20-abx386067
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Hydroxyacylglutathione Hydrolase (HAGH) ELISA Kit
abx252611-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
DLR-BLMH-Hu-48T 48T
EUR 517
  • Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
DLR-BLMH-Hu-96T 96T
EUR 673
  • Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Bleomycin hydrolase(BLMH) ELISA kit
CSB-EL002716HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase (BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Bleomycin hydrolase(BLMH) ELISA kit
1-CSB-EL002716HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase(BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
SEC220Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

Human Bleomycin Hydrolase (BLMH) ELISA Kit
4-SEC220Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Bleomycin Hydrolase elisa. Alternative names of the recognized antigen: BH
  • BMH
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Bleomycin Hydrolase ELISA Kit (BLMH)
RK00979 96 Tests
EUR 521

Human Fumarylacetoacetate Hydrolase ELISA Kit (FAH)
RK01355 96 Tests
EUR 521

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RD-BLMH-Hu-48Tests 48 Tests
EUR 521

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RD-BLMH-Hu-96Tests 96 Tests
EUR 723

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RDR-BLMH-Hu-48Tests 48 Tests
EUR 544

Human Bleomycin Hydrolase (BLMH) ELISA Kit
RDR-BLMH-Hu-96Tests 96 Tests
EUR 756

Human Hydroxyacylglutathione Hydrolase(HAGH)ELISA Kit
QY-E01881 96T
EUR 361

Human Fumarylacetoacetate Hydrolase(FAH)ELISA Kit
QY-E00564 96T
EUR 361

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
SEJ123Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit
4-SEJ123Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA
  • Fumarylacetoacetase
  • Tyrosinemia 1
  • Beta-diketonase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

AOAH ORF Vector (Human) (pORF)
ORF000466 1.0 ug DNA
EUR 95

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

Polyclonal AOAH Antibody (Center)
APG01894G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AOAH (Center). This antibody is tested and proven to work in the following applications:

Mouse AOAH shRNA Plasmid
20-abx973823
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AOAH Antibody, HRP conjugated
1-CSB-PA001853LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOAH. Recognizes AOAH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AOAH Antibody, FITC conjugated
1-CSB-PA001853LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOAH. Recognizes AOAH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AOAH Antibody, Biotin conjugated
1-CSB-PA001853LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOAH. Recognizes AOAH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pECMV-Aoah-m-FLAG
PVT17667 2 ug
EUR 258

AOAH Recombinant Protein (Rat)
RP190382 100 ug Ask for price

AOAH Recombinant Protein (Mouse)
RP116180 100 ug Ask for price

Human S-formylglutathione hydrolase (ESD) ELISA Kit
abx555912-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
abx572445-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Epoxide hydrolase 1(EPHX1) ELISA kit
E01E0380-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 1(EPHX1) ELISA kit
E01E0380-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 1(EPHX1) ELISA kit
E01E0380-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit
E01E0381-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit
E01E0381-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Epoxide hydrolase 2(EPHX2) ELISA kit
E01E0381-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit
E01L0040-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit
E01L0040-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit
E01L0040-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human EPHX4/ Epoxide hydrolase 4 ELISA Kit
E0804Hu 1 Kit
EUR 571

Human ESD/ S-formylglutathione hydrolase ELISA Kit
E0819Hu 1 Kit
EUR 605

Human GGH(Gamma-glutamyl hydrolase) ELISA Kit
EH4206 96T
EUR 524.1
  • Detection range: 0.469-30 ng/ml
  • Uniprot ID: Q92820
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.281 ng/ml

Human EPHX4(Epoxide hydrolase 4) ELISA Kit
EH2072 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q8IUS5
  • Alias: EPHX4(Epoxide hydrolase 4)/ABHD7/EPHXRP/Abhydrolase domain-containing protein 7/Epoxide hydrolase-related protein
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human LTA4H(Leukotriene A4 Hydrolase) ELISA Kit
EH3307 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P09960
  • Alias: LTA4H/EC 3.3.2.6/Leukotriene A(4) hydrolase/leukotriene A4 hydrolase/leukotriene A-4 hydrolase/LTA4/LTA-4 hydrolase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Putative hydrolase RBBP9, RBBP9 ELISA KIT
ELI-14004h 96 Tests
EUR 824

Human Lactase- phlorizin hydrolase, LCT ELISA KIT
ELI-23573h 96 Tests
EUR 824

Human Epoxide hydrolase 4, EPHX4 ELISA KIT
ELI-06582h 96 Tests
EUR 824

Human Mitochondrial cardiolipin hydrolase, PLD6 ELISA KIT
ELI-15234h 96 Tests
EUR 824

Human Epoxide hydrolase 3, EPHX3 ELISA KIT
ELI-09713h 96 Tests
EUR 824

ELISA kit for Human BLMH (Bleomycin Hydrolase)
ELK3153 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bleomycin Hydrolase (BLMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bleomyc
  • Show more
Description: A sandwich ELISA kit for detection of Bleomycin Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human FAH (Fumarylacetoacetate Hydrolase)
ELK4894 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fumarylacetoacetate Hydrolase (FAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Fumarylacetoacetate Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Ester hydrolase C11orf54, C11orf54 ELISA KIT
ELI-33206h 96 Tests
EUR 824

Human Probable hydrolase PNKD, PNKD ELISA KIT
ELI-36132h 96 Tests
EUR 824

Human Epoxide hydrolase 1, EPHX1 ELISA KIT
ELI-43306h 96 Tests
EUR 824

Human Gamma- glutamyl hydrolase, GGH ELISA KIT
ELI-47204h 96 Tests
EUR 824

Human Epoxide hydrolase 2, EPHX2 ELISA KIT
ELI-42180h 96 Tests
EUR 824

Human gamma Glutamyl Hydrolase (gGH) ELISA Kit
20-abx151653
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
20-abx152241
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human ADP Ribosylarginine Hydrolase (ADPRH) ELISA Kit
20-abx258631
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Nudix Hydrolase 8 (NUDT8) ELISA Kit
abx381920-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Probable hydrolase PNKD (PNKD) ELISA Kit
abx382321-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Hydroxyacylglutathione Hydrolase Like (HAGHL) ELISA Kit
abx385019-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Lactase-phlorizin hydrolase (LCT) ELISA Kit
abx385074-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Gamma-Glutamyl Hydrolase (GGH) ELISA Kit
abx257522-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Epoxide Hydrolase 4 (EPHX4) ELISA Kit
abx251403-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
abx252710-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human peptidyl-tRNA hydrolase,PTRH ELISA Kit
201-12-2032 96 tests
EUR 440
  • This peptidyl-tRNA hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
DLR-LTA4H-Hu-48T 48T
EUR 517
  • Should the Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukotriene A4 Hydrolase (LTA4H) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit
DLR-LTA4H-Hu-96T 96T
EUR 673
  • Should the Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leukotriene A4 Hydrolase (LTA4H) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
DLR-gGH-Hu-48T 48T
EUR 517
  • Should the Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Gamma-Glutamyl Hydrolase (gGH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit
DLR-gGH-Hu-96T 96T
EUR 673
  • Should the Human Gamma-Glutamyl Hydrolase (gGH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Gamma-Glutamyl Hydrolase (gGH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Lactase-phlorizin hydrolase(LCT) ELISA kit
CSB-EL012827HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Lactase-phlorizin hydrolase (LCT) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human AOAH(Acyloxyacyl Hydrolase) ELISA Kit