Human ASTL(Astacin Like Metallo Endopeptidase) ELISA Kit

Human ASTL(Astacin Like Metallo Endopeptidase) ELISA Kit

Human Astacin Like Metallo Endopeptidase (ASTL) ELISA Kit

RD-ASTL-Hu-48Tests 48 Tests
EUR 521

Human Astacin Like Metallo Endopeptidase (ASTL) ELISA Kit

RD-ASTL-Hu-96Tests 96 Tests
EUR 723

Astacin Like Metallo Endopeptidase (ASTL) Antibody

20-abx175486
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Astacin Like Metallo Endopeptidase (ASTL) Antibody

abx037138-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Astacin Like Metallo Endopeptidase (ASTL) Antibody

20-abx171340
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Astacin Like Metallo Endopeptidase (ASTL) Antibody

20-abx301452
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Astacin Like Metallo Endopeptidase (ASTL) Antibody

abx230651-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human Astacin Like Metallo Endopeptidase (ASTL)ELISA Kit

201-12-2834 96 tests
EUR 440
  • This Astacin Like Metallo Endopeptidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Astacin Like Metallo Endopeptidase (ASTL) ELISA Kit

20-abx150762
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Astacin Like Metallo Endopeptidase(ASTL)ELISA Kit

QY-E02228 96T
EUR 361

Human Astacin Like Metallo Endopeptidase (ASTL) ELISA Kit

SEJ593Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Astacin Like Metallo Endopeptidase (ASTL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Astacin Like Metallo Endopeptidase (ASTL) in Tissue homogenates and other biological fluids.

Human Astacin Like Metallo Endopeptidase (ASTL) ELISA Kit

SEJ593Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Astacin Like Metallo Endopeptidase (ASTL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Astacin Like Metallo Endopeptidase (ASTL) in Tissue homogenates and other biological fluids.

Human Astacin Like Metallo Endopeptidase (ASTL) ELISA Kit

SEJ593Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Astacin Like Metallo Endopeptidase (ASTL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Astacin Like Metallo Endopeptidase (ASTL) in Tissue homogenates and other biological fluids.

Human Astacin Like Metallo Endopeptidase (ASTL) ELISA Kit

SEJ593Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Astacin Like Metallo Endopeptidase (ASTL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Astacin Like Metallo Endopeptidase (ASTL) in Tissue homogenates and other biological fluids.

Human Astacin Like Metallo Endopeptidase (ASTL) ELISA Kit

4-SEJ593Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Astacin Like Metallo Endopeptidase elisa. Alternative names of the recognized antigen: Ovastacin
  • Oocyte astacin
  • Astacin-Like Metalloendopeptidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Astacin Like Metallo Endopeptidase (ASTL) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Astacin Like Metallo Endopeptidase (ASTL) Protein

20-abx652596
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Astacin Like Metallo Endopeptidase (ASTL) CLIA Kit

20-abx495743
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Astacin Like Metallo Endopeptidase (ASTL) Antibody (HRP)

20-abx308044
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Astacin Like Metallo Endopeptidase (ASTL) Antibody (FITC)

20-abx308045
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Astacin Like Metallo Endopeptidase (ASTL) Antibody (Biotin)

20-abx308046
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human ASTL (Astacin Like Metallo Endopeptidase)

ELK3979 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Astacin Like Metallo Endopeptidase (ASTL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of Astacin Like Metallo Endopeptidase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Astacin-like metalloendopeptidase (ASTL)

1-CSB-EP760708HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Astacin-like metalloendopeptidase(ASTL) expressed in E.coli

Human Astacin like metalloendopeptidase(ASTL) ELISA kit

E01A1732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Astacin like metalloendopeptidase(ASTL) ELISA kit

E01A1732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Astacin like metalloendopeptidase(ASTL) ELISA kit

E01A1732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ASTL(Astacin-like metalloendopeptidase) ELISA Kit

EH6508 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Astacin- like metalloendopeptidase, ASTL ELISA KIT

ELI-49584h 96 Tests
EUR 824

Rat Astacin like metalloendopeptidase(ASTL) ELISA kit

E02A1732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Astacin like metalloendopeptidase(ASTL) ELISA kit

E02A1732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Astacin like metalloendopeptidase(ASTL) ELISA kit

E02A1732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Astacin like metalloendopeptidase(ASTL) ELISA kit

E06A1732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Astacin like metalloendopeptidase(ASTL) ELISA kit

E06A1732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Astacin like metalloendopeptidase(ASTL) ELISA kit

E06A1732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Astacin like metalloendopeptidase(ASTL) ELISA kit

E03A1732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Astacin like metalloendopeptidase(ASTL) ELISA kit

E03A1732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Astacin like metalloendopeptidase(ASTL) ELISA kit

E03A1732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Astacin like metalloendopeptidase(ASTL) ELISA kit

E04A1732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Astacin like metalloendopeptidase(ASTL) ELISA kit

E04A1732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Astacin like metalloendopeptidase(ASTL) ELISA kit

E04A1732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Astacin like metalloendopeptidase(ASTL) ELISA kit

E07A1732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Astacin like metalloendopeptidase(ASTL) ELISA kit

E07A1732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Astacin like metalloendopeptidase(ASTL) ELISA kit

E07A1732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Astacin like metalloendopeptidase(ASTL) ELISA kit

E08A1732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Astacin like metalloendopeptidase(ASTL) ELISA kit

E08A1732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Astacin like metalloendopeptidase(ASTL) ELISA kit

E08A1732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Astacin like metalloendopeptidase(ASTL) ELISA kit

E09A1732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Astacin like metalloendopeptidase(ASTL) ELISA kit

E09A1732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Astacin like metalloendopeptidase(ASTL) ELISA kit

E09A1732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Astacin- like metalloendopeptidase, Astl ELISA KIT

ELI-34391m 96 Tests
EUR 865

Guinea pig Astacin like metalloendopeptidase(ASTL) ELISA kit

E05A1732-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Astacin like metalloendopeptidase(ASTL) ELISA kit

E05A1732-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Astacin like metalloendopeptidase(ASTL) ELISA kit

E05A1732-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Astacin like metalloendopeptidase(ASTL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MMEL1/ Membrane metallo-endopeptidase-like 1 ELISA Kit

E1604Hu 1 Kit
EUR 571

Human MMEL1(Membrane metallo-endopeptidase-like 1) ELISA Kit

EH2061 96T
EUR 524.1
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: Q495T6
  • Alias: MMEL1(Membrane metallo-endopeptidase-like 1)/Neprilysin-2/NEP2/NL2/Neprilysin II/NEPII/Membrane metallo-endopeptidase-like 2/NEP2(m)/MELL1/MMEL2/SEP/soluble secreted endopeptidase/zinc metall
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Membrane metallo- endopeptidase- like 1, MMEL1 ELISA KIT

ELI-06536h 96 Tests
EUR 824

Mouse Membrane metallo- endopeptidase- like 1, Mmel1 ELISA KIT

ELI-06537m 96 Tests
EUR 865

Membrane Metallo-Endopeptidase-Like 1 (MMEL1) Antibody

abx224081-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Membrane Metallo-Endopeptidase-Like 1 (MMEL1) Antibody

abx031409-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Membrane Metallo-Endopeptidase-Like 1 (MMEL1) Antibody

abx031409-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Porcine Membrane metallo endopeptidase, MME ELISA KIT

ELI-05782p 96 Tests
EUR 928

Rat Membrane metallo endopeptidase, MME ELISA KIT

ELI-05783r 96 Tests
EUR 886

Rabbit Membrane metallo endopeptidase, MME ELISA KIT

ELI-05785Ra 96 Tests
EUR 928

Recombinant human Astacin-like metalloendopeptidase

P1839 100ug Ask for price
  • Uniprot ID: Q6HA08
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Astacin-like metalloendopeptidase

Human Prolyl endopeptidase-like (PREPL) ELISA Kit

abx382455-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Prolyl endopeptidase- like, PREPL ELISA KIT

ELI-36168h 96 Tests
EUR 824

ASTL ELISA KIT|Human

EF007950 96 Tests
EUR 689

ELISA kit for Human Prolyl endopeptidase-like (PREPL)

KTE61171-48T 48T
EUR 332
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prolyl endopeptidase-like (PREPL)

KTE61171-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prolyl endopeptidase-like (PREPL)

KTE61171-96T 96T
EUR 539
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Prolyl endopeptidase-like (PREPL) ELISA Kit

abx391849-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Prolyl endopeptidase-like (PREPL) ELISA Kit

abx390309-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Prolyl endopeptidase- like, PREPL ELISA KIT

ELI-36121c 96 Tests
EUR 928

Mouse Prolyl endopeptidase- like, Prepl ELISA KIT

ELI-36227m 96 Tests
EUR 865

Prolyl Endopeptidase-Like Antibody

20-abx114718
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prepl ELISA Kit| Rat Prolyl endopeptidase-like ELISA Kit

EF019209 96 Tests
EUR 689

Prepl ELISA Kit| Mouse Prolyl endopeptidase-like ELISA Kit

EF015949 96 Tests
EUR 689

PREPL ELISA Kit| chicken Prolyl endopeptidase-like ELISA Kit

EF012472 96 Tests
EUR 689

ASTL ELISA Kit (Human) (OKCD09209)

OKCD09209 96 Wells
EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL

ASTL ELISA Kit (Human) (OKDD00137)

OKDD00137 96 Wells
EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.06 ng/mL

ELISA kit for Rat Prolyl endopeptidase-like (PREPL)

KTE100444-48T 48T
EUR 332
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Prolyl endopeptidase-like (PREPL)

KTE100444-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Prolyl endopeptidase-like (PREPL)

KTE100444-96T 96T
EUR 539
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prolyl endopeptidase-like (PREPL)

KTE71437-48T 48T
EUR 332
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prolyl endopeptidase-like (PREPL)

KTE71437-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prolyl endopeptidase-like (PREPL)

KTE71437-96T 96T
EUR 539
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Prolyl endopeptidase-like (PREPL)

KTE30062-48T 48T
EUR 354
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Prolyl endopeptidase-like (PREPL)

KTE30062-5platesof96wells 5 plates of 96 wells
EUR 2252
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Prolyl endopeptidase-like (PREPL)

KTE30062-96T 96T
EUR 572
  • PREPL belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants enc
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Prolyl endopeptidase-like (PREPL) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Prolyl Endopeptidase-Like (PREPL) Antibody

20-abx003213
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Prolyl Endopeptidase-Like (PREPL) Antibody

abx032557-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prolyl Endopeptidase-Like (PREPL) Antibody

abx032557-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Prolyl Endopeptidase-Like (PREPL) Antibody

abx236768-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human Prolyl endopeptidase(PREP) ELISA kit

E01P0865-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prolyl endopeptidase(PREP) ELISA kit

E01P0865-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Prolyl endopeptidase(PREP) ELISA kit

E01P0865-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human PREP(Prolyl endopeptidase) ELISA Kit

EH11393 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Prolyl endopeptidase, PREP ELISA KIT

ELI-45388h 96 Tests
EUR 824

Human Prolyl endopeptidase (PREP) ELISA Kit

20-abx382454
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Prolyl Endopeptidase(PREP)ELISA Kit

QY-E03541 96T
EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

ASTL Antibody

39946-100ul 100ul
EUR 390

ASTL Antibody

1-CSB-PA760708LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASTL. Recognizes ASTL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ASTL siRNA

20-abx908387
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASTL siRNA

20-abx908388
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human FAP/ Prolyl endopeptidase FAP ELISA Kit

E0862Hu 1 Kit
EUR 605

ELISA kit for Human Prolyl endopeptidase (PREP)

KTE61172-48T 48T
EUR 332
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prolyl endopeptidase (PREP)

KTE61172-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prolyl endopeptidase (PREP)

KTE61172-96T 96T
EUR 539
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human O-Sialoglycoprotein Endopeptidase(OSGEP)ELISA Kit

QY-E04719 96T
EUR 394

Human ASTL shRNA Plasmid

20-abx968219
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASTL Recombinant Protein (Human)

RP036790 100 ug Ask for price

Rabbit Prolyl endopeptidase(PREP) ELISA kit

E04P0865-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prolyl endopeptidase(PREP) ELISA kit

E04P0865-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prolyl endopeptidase(PREP) ELISA kit

E04P0865-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prolyl endopeptidase(PREP) ELISA kit

E02P0865-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prolyl endopeptidase(PREP) ELISA kit

E02P0865-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prolyl endopeptidase(PREP) ELISA kit

E02P0865-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prolyl endopeptidase(PREP) ELISA kit

E03P0865-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prolyl endopeptidase(PREP) ELISA kit

E03P0865-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Prolyl endopeptidase(PREP) ELISA kit

E03P0865-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Prolyl endopeptidase(PREP) ELISA kit

E06P0865-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Prolyl endopeptidase(PREP) ELISA kit

E06P0865-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Prolyl endopeptidase(PREP) ELISA kit

E06P0865-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Prolyl endopeptidase(PREP) ELISA kit

E08P0865-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Prolyl endopeptidase(PREP) ELISA kit

E08P0865-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Prolyl endopeptidase(PREP) ELISA kit

E08P0865-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Prolyl endopeptidase(PREP) ELISA kit

E07P0865-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Prolyl endopeptidase(PREP) ELISA kit

E07P0865-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Prolyl endopeptidase(PREP) ELISA kit

E07P0865-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Prolyl endopeptidase(PREP) ELISA kit

E09P0865-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Prolyl endopeptidase(PREP) ELISA kit

E09P0865-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Prolyl endopeptidase(PREP) ELISA kit

E09P0865-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Prolyl endopeptidase, PREP ELISA KIT

ELI-16576p 96 Tests
EUR 928

Bovine Prolyl endopeptidase, PREP ELISA KIT

ELI-19714b 96 Tests
EUR 928

Rat Prolyl endopeptidase (PREP) ELISA Kit

20-abx391848
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Cow Prolyl endopeptidase (PREP) ELISA Kit

20-abx380739
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Prolyl endopeptidase (PREP) ELISA Kit

20-abx390308
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Prolyl endopeptidase, Prep ELISA KIT

ELI-37820m 96 Tests
EUR 865

Lysyl endopeptidase

1-CSB-YP745349LLBa0
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Lysyl endopeptidase expressed in Yeast

Prep ELISA Kit| Rat Prolyl endopeptidase ELISA Kit

EF019208 96 Tests
EUR 689

Prep ELISA Kit| Mouse Prolyl endopeptidase ELISA Kit

EF015948 96 Tests
EUR 689

PREP ELISA Kit| Bovine Prolyl endopeptidase ELISA Kit

EF011793 96 Tests
EUR 689

ASTL Polyclonal Antibody

28793-100ul 100ul
EUR 252

ASTL Polyclonal Antibody

28793-50ul 50ul
EUR 187

ASTL cloning plasmid

CSB-CL760708HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1296
  • Sequence: ATGGAGGGTGTAGGGGGTCTCTGGCCTTGGGTGCTGGGTCTGCTCTCCTTGCCAGGTGTGATCCTAGGAGCGCCCCTGGCCTCCAGCTGCGCAGGAGCCTGTGGTACCAGCTTCCCAGATGGCCTCACCCCTGAGGGAACCCAGGCCTCCGGGGACAAGGACATTCCTGCAATTA
  • Show more
Description: A cloning plasmid for the ASTL gene.

ASTL Polyclonal Antibody

A65638 100 µg
EUR 570.55
Description: The best epigenetics products

ASTL Rabbit pAb

A14984-100ul 100 ul
EUR 308

ASTL Rabbit pAb

A14984-200ul 200 ul
EUR 459

ASTL Rabbit pAb

A14984-20ul 20 ul
EUR 183

ASTL Rabbit pAb

A14984-50ul 50 ul
EUR 223

anti- ASTL antibody

FNab00651 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: astacin-like metallo-endopeptidase(M12 family)
  • Uniprot ID: Q6HA08
  • Gene ID: 431705
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against ASTL

Anti-ASTL antibody

PAab00651 100 ug
EUR 355

Anti-ASTL antibody

STJ117183 100 µl
EUR 277

Human Metallo-beta-Lactamase Domain Containing 1 (MBLAC1) ELISA Kit

abx251685-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Metallo Beta-Lactamase Domain Containing 2 (MBLAC2) ELISA Kit

abx385147-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ASTL ORF Vector (Human) (pORF)

ORF012264 1.0 ug DNA
EUR 354

Mouse Fap/ Prolyl endopeptidase FAP ELISA Kit

E0506Mo 1 Kit
EUR 632

Guinea pig Prolyl endopeptidase(PREP) ELISA kit

E05P0865-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Prolyl endopeptidase(PREP) ELISA kit

E05P0865-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Prolyl endopeptidase(PREP) ELISA kit

E05P0865-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Prolyl endopeptidase(PREP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Prolyl endopeptidase (PREP)

KTE100445-48T 48T
EUR 332
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Prolyl endopeptidase (PREP)

KTE100445-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Prolyl endopeptidase (PREP)

KTE100445-96T 96T
EUR 539
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Prolyl endopeptidase (PREP)

KTE10186-48T 48T
EUR 354
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Prolyl endopeptidase (PREP)

KTE10186-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Prolyl endopeptidase (PREP)

KTE10186-96T 96T
EUR 572
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Prolyl endopeptidase (PREP)

KTE80077-48T 48T
EUR 354
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Prolyl endopeptidase (PREP)

KTE80077-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Prolyl endopeptidase (PREP)

KTE80077-96T 96T
EUR 572
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prolyl endopeptidase (PREP)

KTE70687-48T 48T
EUR 332
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prolyl endopeptidase (PREP)

KTE70687-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Prolyl endopeptidase (PREP)

KTE70687-96T 96T
EUR 539
  • Prolyl endopeptidase (PE) also known as prolyl oligopeptidase or post-proline cleaving enzyme is an enzyme that in humans is encoded by the PREP gene.Prolyl endopeptidase is a large cytosolic enzyme that belongs to a distinct class of serine peptidas
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Prolyl endopeptidase (PREP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Fap ELISA Kit| Mouse Prolyl endopeptidase FAP ELISA Kit

EF014918 96 Tests
EUR 689

Mblac1 ELISA Kit| Rat Metallo-beta-lactamase domain-containing

EF018956 96 Tests
EUR 689

Mblac1 ELISA Kit| Mouse Metallo-beta-lactamase domain-containin

EF015490 96 Tests
EUR 689

Mblac2 ELISA Kit| Mouse Metallo-beta-lactamase domain-containin

EF015491 96 Tests
EUR 689

MBLAC1 ELISA Kit| Bovine Metallo-beta-lactamase domain-containi

EF011592 96 Tests
EUR 689

MBLAC2 ELISA Kit| Bovine Metallo-beta-lactamase domain-containi

EF011593 96 Tests
EUR 689

MBLAC2 ELISA Kit| chicken Metallo-beta-lactamase domain-contain

EF012389 96 Tests
EUR 689

Human Procollagen C-endopeptidase enhancer 2(PCOLCE2) ELISA kit

CSB-EL017632HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Procollagen C-endopeptidase enhancer 2 (PCOLCE2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Procollagen C-endopeptidase enhancer 2(PCOLCE2) ELISA kit

1-CSB-EL017632HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Procollagen C-endopeptidase enhancer 2(PCOLCE2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Procollagen C-endopeptidase enhancer 1 (PCOLCE) ELISA Kit

abx251812-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Procollagen C-endopeptidase enhancer 1

EK4920 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Procollagen C-endopeptidase enhancer 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PCOLCE/ Procollagen C-endopeptidase enhancer 1 ELISA Kit

E1877Hu 1 Kit
EUR 605

Human Procollagen C- endopeptidase enhancer 2, PCOLCE2 ELISA KIT

ELI-16107h 96 Tests
EUR 824

Human Procollagen C- endopeptidase enhancer 1, PCOLCE ELISA KIT

ELI-07704h 96 Tests
EUR 824

Human Procollagen C-endopeptidase enhancer 2 (PCOLCE2) ELISA Kit

abx382101-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Prolyl Endopeptidase Antibody

47987-100ul 100ul
EUR 252

Prolyl Endopeptidase Antibody

20-abx114717
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Legumain/Asparaginyl Endopeptidase

E21-371 10ug
EUR 343

Prolyl Endopeptidase Antibody

abx430973-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

anti-Prolyl Endopeptidase

YF-PA13967 50 ul
EUR 363
Description: Mouse polyclonal to Prolyl Endopeptidase

Human MBLAC1(Metallo-beta-lactamase domain-containing protein 1) ELISA Kit

EH2330 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: A4D2B0
  • Alias: MBLAC1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

ELISA kit for Human Metallo-beta-lactamase domain-containing protein 1

EK4698 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Metallo-beta-lactamase domain-containing protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human MBLAC1/ Metallo-beta-lactamase domain-containing protein 1 ELISA Kit

E1559Hu 1 Kit
EUR 605

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ASTL Antibody, HRP conjugated

1-CSB-PA760708LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASTL. Recognizes ASTL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Human ASTL(Astacin Like Metallo Endopeptidase) ELISA Kit