Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit

Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
RDR-BANP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
RDR-BANP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
RD-BANP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
RD-BANP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human BTG3 Associated Nuclear Protein (BANP)ELISA Kit
201-12-2851	SunredBio	96 tests	EUR 440
This BTG3 Associated Nuclear Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
20-abx150788	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
abx252071-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit
EH2692	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q8N9N5 Alias: BANP/BEND1/SMAR1/Scaffold/matrix-associated region-1-binding protein/BEN domain-containing protein 1/Btg3-associated nuclear protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human BTG3 Associated Nuclear Protein(BANP)ELISA Kit
QY-E05109	Qayee Biotechnology	96T	EUR 400

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
SEJ564Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
SEJ564Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
SEJ564Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
SEJ564Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit
4-SEJ564Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as BTG3 Associated Nuclear Protein elisa. Alternative names of the recognized antigen: SMAR1 SMARBP1 BEND1 BEN Domain Containing 1 Scaffold/matrix-associated region-1-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human BTG3 Associated Nuclear Protein (BANP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

BTG3 Associated Nuclear Protein (BANP) Antibody
20-abx006024	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

BTG3 Associated Nuclear Protein (BANP) Antibody
20-abx003640	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

BTG3 Associated Nuclear Protein (BANP) Antibody
20-abx175631	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

BTG3 Associated Nuclear Protein (BANP) Antibody
20-abx111276	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

BTG3 Associated Nuclear Protein (BANP) Antibody
20-abx171483	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

BTG3 Associated Nuclear Protein (BANP) Antibody
20-abx321572	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

BTG3 Associated Nuclear Protein (BANP) Antibody
abx230799-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Human BTG3 Associated Nuclear Protein (BANP) Protein
20-abx652714	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pig BTG3 Associated Nuclear Protein (BANP) ELISA Kit
abx360616-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse BTG3 Associated Nuclear Protein (BANP) ELISA Kit
abx392280-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Monkey BTG3 Associated Nuclear Protein (BANP) ELISA Kit
abx358944-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken BTG3 Associated Nuclear Protein (BANP) ELISA Kit
abx355576-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit BTG3 Associated Nuclear Protein (BANP) ELISA Kit
abx363558-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human BTG3 Associated Nuclear Protein (BANP) CLIA Kit
abx196493-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human BTG3 Associated Nuclear Protein (BANP) CLIA Kit
20-abx495739	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human BANP (BTG3 Associated Nuclear Protein)
E-EL-H2430	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's BANP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human BANP. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human BANP (BTG3 Associated Nuclear Protein) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human BANP (BTG3 Associated Nuclear Protein)
ELK3666	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to BTG3 Associated Nuclear Protein (BANP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi Show more
Description: A sandwich ELISA kit for detection of BTG3 Associated Nuclear Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig BTG3 Associated Nuclear Protein (BANP) ELISA Kit
abx357232-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

CLIA kit for Human BANP (BTG3 Associated Nuclear Protein)
E-CL-H1430	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's BANP CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human BANP . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human BANP (BTG3 Associated Nuclear Protein) in samples from Serum, Plasma, Cell supernatant

Human Protein BANP, BANP ELISA KIT
ELI-23978h	Lifescience Market	96 Tests	EUR 824

Human BTG3/ Protein BTG3 ELISA Kit
E0301Hu	Sunlong	1 Kit	EUR 605

Human Protein BTG3(BTG3) ELISA kit
E01P0800-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein BTG3(BTG3) ELISA kit
E01P0800-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein BTG3(BTG3) ELISA kit
E01P0800-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein BTG3 (BTG3) ELISA Kit
abx250919-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human BTG3(Protein BTG3) ELISA Kit
EH1626	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: Q14201 Alias: BTG3/Protein BTG3/Protein Tob5/Abundant in neuroepithelium area protein/BTG family member 3/ANA/TOB5/TOB55/TOFA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Protein BTG3, BTG3 ELISA KIT
ELI-33291h	Lifescience Market	96 Tests	EUR 824

Mouse Protein BANP, Banp ELISA KIT
ELI-34748m	Lifescience Market	96 Tests	EUR 865

Bovine Protein BANP, BANP ELISA KIT
ELI-49628b	Lifescience Market	96 Tests	EUR 928

Mouse Btg3/ Protein BTG3 ELISA Kit
E0188Mo	Sunlong	1 Kit	EUR 632

Rabbit Protein BTG3(BTG3) ELISA kit
E04P0800-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein BTG3(BTG3) ELISA kit
E04P0800-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein BTG3(BTG3) ELISA kit
E04P0800-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein BTG3(BTG3) ELISA kit
E02P0800-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein BTG3(BTG3) ELISA kit
E02P0800-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein BTG3(BTG3) ELISA kit
E02P0800-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein BTG3(BTG3) ELISA kit
E03P0800-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein BTG3(BTG3) ELISA kit
E03P0800-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein BTG3(BTG3) ELISA kit
E03P0800-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein BTG3(BTG3) ELISA kit
E06P0800-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein BTG3(BTG3) ELISA kit
E06P0800-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein BTG3(BTG3) ELISA kit
E06P0800-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein BTG3(BTG3) ELISA kit
E08P0800-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein BTG3(BTG3) ELISA kit
E08P0800-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein BTG3(BTG3) ELISA kit
E08P0800-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein BTG3(BTG3) ELISA kit
E07P0800-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein BTG3(BTG3) ELISA kit
E07P0800-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein BTG3(BTG3) ELISA kit
E07P0800-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein BTG3(BTG3) ELISA kit
E09P0800-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein BTG3(BTG3) ELISA kit
E09P0800-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein BTG3(BTG3) ELISA kit
E09P0800-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Protein BTG3, BTG3 ELISA KIT
ELI-11196p	Lifescience Market	96 Tests	EUR 928

Mouse Protein BTG3, Btg3 ELISA KIT
ELI-25358m	Lifescience Market	96 Tests	EUR 865

Pig Protein BTG3 (BTG3) ELISA Kit
abx517017-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Protein BTG3 (BTG3) ELISA Kit
abx517018-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Protein BTG3 (BTG3) ELISA Kit
abx500340-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Banp ELISA Kit| Mouse Protein BANP ELISA Kit
EF015964	Lifescience Market	96 Tests	EUR 689

BANP ELISA Kit| Bovine Protein BANP ELISA Kit
EF011803	Lifescience Market	96 Tests	EUR 689

Btg3 ELISA Kit| Rat Protein BTG3 ELISA Kit
EF018397	Lifescience Market	96 Tests	EUR 689

Btg3 ELISA Kit| Mouse Protein BTG3 ELISA Kit
EF014349	Lifescience Market	96 Tests	EUR 689

Btg3/ Rat Btg3 ELISA Kit
ELI-25127r	Lifescience Market	96 Tests	EUR 886

Guinea pig Protein BTG3(BTG3) ELISA kit
E05P0800-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein BTG3(BTG3) ELISA kit
E05P0800-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein BTG3(BTG3) ELISA kit
E05P0800-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

BANP ELISA KIT|Human
EF006633	Lifescience Market	96 Tests	EUR 689

Human BTG3 ELISA Kit
ELA-E14584h	Lifescience Market	96 Tests	EUR 824

BTG3 ELISA KIT|Human
EF005776	Lifescience Market	96 Tests	EUR 689

Protein BTG3 (BTG3) Antibody
20-abx006733	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Protein BTG3 (BTG3) Antibody
abx026996-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Protein BTG3 (BTG3) Antibody
abx026996-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Protein BTG3 (BTG3) Antibody
20-abx339731	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Human Protein BTG3
EK3430	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein BTG3 in samples from serum, plasma, tissue homogenates and other biological fluids.

BANP ELISA Kit (Human) (OKCD09208)
OKCD09208	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: BTG3 associated nuclear protein;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

BANP ELISA Kit (Human) (OKDD00146)
OKDD00146	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

BTG3 ELISA Kit (Human) (OKEH02362)
OKEH02362	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein might play a role in neurogenesis in the central nervous system. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15 pg/mL

BANP Recombinant Protein (Human)
RP002620	ABM	100 ug	Ask for price

BTG3 Recombinant Protein (Human)
RP003271	ABM	100 ug	Ask for price

BTG3 ELISA Kit (Mouse) (OKEH05483)
OKEH05483	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Overexpression impairs serum-induced cell cycle progression from the G0/G1 to S phase. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

BTG3 ELISA Kit (Pig) (OKEH08035)
OKEH08035	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Germinal-Center Associated Nuclear Protein (GANP) ELISA Kit
abx595247-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Human Rheumatoid arthritis associated nuclear artigen ELISA kit
E01R0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Rheumatoid arthritis associated nuclear artigen ELISA kit
E01R0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Rheumatoid arthritis associated nuclear artigen ELISA kit
E01R0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human rheumatoid arthritis associated nuclear artigen ELISA Kit
ELA-E0486h	Lifescience Market	96 Tests	EUR 824

Human Gem Nuclear Organelle Associated Protein 2 (SIP1) ELISA Kit
abx383207-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

BANP Antibody
25189-100ul	SAB	100ul	EUR 390

BANP antibody
70R-15961	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal BANP antibody

BANP Antibody
1-CSB-PA002555GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BANP. Recognizes BANP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BANP Antibody
1-CSB-PA854079ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BANP. Recognizes BANP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

BANP Antibody
DF12849	Affbiotech	200ul	EUR 304
Description: BANP Antibody detects endogenous levels of BANP.

BANP siRNA
20-abx908877	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BANP siRNA
20-abx908878	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-BANP
YF-PA19487	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to BANP

anti-BANP
YF-PA19488	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to BANP

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

BTG3 Antibody
35655-100ul	SAB	100ul	EUR 252

BTG3 Antibody
1-CSB-PA969912	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BTG3. Recognizes BTG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

BTG3 siRNA
20-abx900690	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BTG3 siRNA
20-abx909384	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BTG3 siRNA
20-abx909385	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BANP Recombinant Protein (Mouse)
RP118724	ABM	100 ug	Ask for price

BANP Recombinant Protein (Mouse)
RP118727	ABM	100 ug	Ask for price

BANP Recombinant Protein (Rat)
RP191867	ABM	100 ug	Ask for price

Human rheumatoid arthritis associated nuclear artigen,RANA ELISA Kit
201-12-0448	SunredBio	96 tests	EUR 440
This rheumatoid arthritis associated nuclear artigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human rheumatoid arthritis associated nuclear artigen(RANA)ELISA Kit
GA-E0464HM-48T	GenAsia Biotech	48T	EUR 289

Human rheumatoid arthritis associated nuclear artigen(RANA)ELISA Kit
GA-E0464HM-96T	GenAsia Biotech	96T	EUR 466

Human rheumatoid arthritis associated nuclear artigen(RANA)ELISA Kit
QY-E02600	Qayee Biotechnology	96T	EUR 361

Human BANP shRNA Plasmid
20-abx960369	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

BTG3 Recombinant Protein (Rat)
RP192542	ABM	100 ug	Ask for price

BTG3 Recombinant Protein (Mouse)
RP120095	ABM	100 ug	Ask for price

Human BTG3 shRNA Plasmid
20-abx957472	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rabbit Rheumatoid arthritis associated nuclear artigen ELISA kit
E04R0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Rheumatoid arthritis associated nuclear artigen ELISA kit
E04R0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Rheumatoid arthritis associated nuclear artigen ELISA kit
E04R0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rheumatoid arthritis associated nuclear artigen ELISA kit
E02R0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rheumatoid arthritis associated nuclear artigen ELISA kit
E02R0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rheumatoid arthritis associated nuclear artigen ELISA kit
E02R0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Rheumatoid arthritis associated nuclear artigen ELISA kit
E03R0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Rheumatoid arthritis associated nuclear artigen ELISA kit
E03R0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Rheumatoid arthritis associated nuclear artigen ELISA kit
E03R0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Rheumatoid arthritis associated nuclear artigen ELISA kit
E06R0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Rheumatoid arthritis associated nuclear artigen ELISA kit
E06R0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Rheumatoid arthritis associated nuclear artigen ELISA kit
E06R0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Rheumatoid arthritis associated nuclear artigen ELISA kit
E08R0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Rheumatoid arthritis associated nuclear artigen ELISA kit
E08R0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Rheumatoid arthritis associated nuclear artigen ELISA kit
E08R0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Rheumatoid arthritis associated nuclear artigen ELISA kit
E09R0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Rheumatoid arthritis associated nuclear artigen ELISA kit
E09R0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Rheumatoid arthritis associated nuclear artigen ELISA kit
E09R0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Rheumatoid arthritis associated nuclear artigen ELISA kit
E07R0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Rheumatoid arthritis associated nuclear artigen ELISA kit
E07R0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Rheumatoid arthritis associated nuclear artigen ELISA kit
E07R0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human LSM10, U7 Small Nuclear RNA Associated (LSM10) ELISA Kit
abx388332-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human LSM11, U7 Small Nuclear RNA Associated (LSM11) ELISA Kit
abx388333-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

BANP Polyclonal Antibody
30977-100ul	SAB	100ul	EUR 252

BANP Polyclonal Antibody
30977-50ul	SAB	50ul	EUR 187

BANP Blocking Peptide
DF12849-BP	Affbiotech	1mg	EUR 195

BANP cloning plasmid
CSB-CL854079HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1410 Sequence: atgatgtcggaacacgacctggccgatgtggttcagattgcagtggaagacctgagccctgaccacccagttgttttggagaatcatgtagtgacagatgaagacgaacctgctttgaaacgccagcgactagaaatcaattgccaggatccatctataaagtcattcctgtatt Show more
Description: A cloning plasmid for the BANP gene.

BANP Rabbit pAb
A7595-100ul	Abclonal	100 ul	EUR 308

BANP Rabbit pAb
A7595-200ul	Abclonal	200 ul	EUR 459

BANP Rabbit pAb
A7595-20ul	Abclonal	20 ul	EUR 183

BANP Rabbit pAb
A7595-50ul	Abclonal	50 ul	EUR 223

BANP Rabbit pAb
A19475-100ul	Abclonal	100 ul	Ask for price

BANP Rabbit pAb
A19475-200ul	Abclonal	200 ul	Ask for price

BANP Rabbit pAb
A19475-20ul	Abclonal	20 ul	Ask for price

BANP Rabbit pAb
A19475-50ul	Abclonal	50 ul	EUR 308

anti- BANP antibody
FNab00799	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: BTG3 associated nuclear protein Uniprot ID: Q8N9N5 Gene ID: 54971 Research Area: Metabolism, Developmental biology
Description: Antibody raised against BANP

Anti-BANP antibody
PAab00799	Lifescience Market	100 ug	EUR 386

Anti-BANP antibody
STJ11100668	St John's Laboratory	50 µl	EUR 287
Description: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-BANP antibody
STJ29732	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

BTG3 Conjugated Antibody
C35655	SAB	100ul	EUR 397

BTG3 cloning plasmid
CSB-CL622758HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 891 Sequence: atgaagaatgaaattgctgccgttgtcttctttttcacaaggctagttcgaaaacatgataagttgaaaaaagaggcagttgagaggtttgctgagaaattgaccctaatacttcaagaaaaatataaaaatcactggtatccagaaaaaccatcgaaaggacaggcctacagatg Show more
Description: A cloning plasmid for the BTG3 gene.

BTG3 Rabbit pAb
A2669-100ul	Abclonal	100 ul	EUR 308

BTG3 Rabbit pAb
A2669-200ul	Abclonal	200 ul	EUR 459

BTG3 Rabbit pAb
A2669-20ul	Abclonal	20 ul	Ask for price

BTG3 Rabbit pAb
A2669-50ul	Abclonal	50 ul	EUR 223

Anti-BTG3 antibody
STJ22843	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein might play a role in neurogenesis in the central nervous system. Two transcript variants encoding different isoforms have been found for this gene.

BANP ORF Vector (Human) (pORF)
ORF000874	ABM	1.0 ug DNA	EUR 95

BANP Protein Vector (Human) (pPB-His-MBP)
PV326250	ABM	500 ng	EUR 329

BANP Protein Vector (Human) (pPB-His-GST)
PV326251	ABM	500 ng	EUR 329

BANP Protein Vector (Human) (pPB-C-His)
PV003493	ABM	500 ng	EUR 329

BANP Protein Vector (Human) (pPB-N-His)
PV003494	ABM	500 ng	EUR 329

BANP Protein Vector (Human) (pPM-C-HA)
PV003495	ABM	500 ng	EUR 329

BANP Protein Vector (Human) (pPM-C-His)
PV003496	ABM	500 ng	EUR 329

Guinea pig Rheumatoid arthritis associated nuclear artigen ELISA kit
E05R0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Rheumatoid arthritis associated nuclear artigen ELISA kit
E05R0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Rheumatoid arthritis associated nuclear artigen ELISA kit
E05R0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

BTG3 ORF Vector (Human) (pORF)
ORF001091	ABM	1.0 ug DNA	EUR 95

BTG3 Protein Vector (Human) (pPB-His-MBP)
PV327858	ABM	500 ng	EUR 329

BTG3 Protein Vector (Human) (pPB-His-GST)
PV327859	ABM	500 ng	EUR 329

BTG3 Protein Vector (Human) (pPB-C-His)
PV004361	ABM	500 ng	EUR 329

BTG3 Protein Vector (Human) (pPB-N-His)
PV004362	ABM	500 ng	EUR 329

BTG3 Protein Vector (Human) (pPM-C-HA)
PV004363	ABM	500 ng	EUR 329

BTG3 Protein Vector (Human) (pPM-C-His)
PV004364	ABM	500 ng	EUR 329

Human LSM8 Homolog, U6 Small Nuclear RNA Associated (LSM8) ELISA Kit
abx388339-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Nuclear Receptor 2C2-Associated Protein (NR2C2AP) Antibody
abx146318-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Germinal-Center Associated Nuclear Protein (GANP) Antibody
20-abx013088	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Nuclear Pore Associated Protein 1 (NPAP1) Antibody
20-abx339916	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Nuclear Pore Associated Protein 1 (NPAP1) Antibody
20-abx339917	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit