Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
RD-BANP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
RD-BANP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
RDR-BANP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
RDR-BANP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit |
EH2692 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q8N9N5
- Alias: BANP/BEND1/SMAR1/Scaffold/matrix-associated region-1-binding protein/BEN domain-containing protein 1/Btg3-associated nuclear protein
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
20-abx150788 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
abx252071-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human BTG3 Associated Nuclear Protein (BANP)ELISA Kit |
201-12-2851 |
SunredBio |
96 tests |
EUR 440 |
- This BTG3 Associated Nuclear Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
SEJ564Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids. |
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
SEJ564Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids. |
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
SEJ564Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids. |
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
SEJ564Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assa
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids. |
Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
4-SEJ564Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as BTG3 Associated Nuclear Protein elisa. Alternative names of the recognized antigen: SMAR1
- SMARBP1
- BEND1
- BEN Domain Containing 1
- Scaffold/matrix-associated region-1-binding protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human BTG3 Associated Nuclear Protein (BANP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
BTG3 Associated Nuclear Protein (BANP) Antibody |
20-abx111276 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BTG3 Associated Nuclear Protein (BANP) Antibody |
20-abx006024 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
BTG3 Associated Nuclear Protein (BANP) Antibody |
20-abx003640 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BTG3 Associated Nuclear Protein (BANP) Antibody |
20-abx175631 |
Abbexa |
|
|
|
BTG3 Associated Nuclear Protein (BANP) Antibody |
20-abx321572 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BTG3 Associated Nuclear Protein (BANP) Antibody |
abx230799-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
BTG3 Associated Nuclear Protein (BANP) Antibody |
20-abx171483 |
Abbexa |
|
|
|
Human BTG3 Associated Nuclear Protein (BANP) Protein |
20-abx652714 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Pig BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
abx360616-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
abx363558-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
abx358944-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
abx355576-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
abx392280-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human BTG3 Associated Nuclear Protein (BANP) CLIA Kit |
20-abx495739 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human BTG3 Associated Nuclear Protein (BANP) CLIA Kit |
abx196493-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Human BANP (BTG3 Associated Nuclear Protein) |
E-EL-H2430 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's BANP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human BANP. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human BANP (BTG3 Associated Nuclear Protein) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human BANP (BTG3 Associated Nuclear Protein) |
ELK3666 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to BTG3 Associated Nuclear Protein (BANP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
- Show more
|
Description: A sandwich ELISA kit for detection of BTG3 Associated Nuclear Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Guinea pig BTG3 Associated Nuclear Protein (BANP) ELISA Kit |
abx357232-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
CLIA kit for Human BANP (BTG3 Associated Nuclear Protein) |
E-CL-H1430 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's BANP CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human BANP . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human BANP (BTG3 Associated Nuclear Protein) in samples from Serum, Plasma, Cell supernatant |
Human BTG3/ Protein BTG3 ELISA Kit |
E0301Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Protein BTG3(BTG3) ELISA kit |
E01P0800-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein BTG3(BTG3) ELISA kit |
E01P0800-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein BTG3(BTG3) ELISA kit |
E01P0800-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human BTG3(Protein BTG3) ELISA Kit |
EH1626 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.2-2000 pg/ml
- Uniprot ID: Q14201
- Alias: BTG3/Protein BTG3/Protein Tob5/Abundant in neuroepithelium area protein/BTG family member 3/ANA/TOB5/TOB55/TOFA
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Protein BTG3 (BTG3) ELISA Kit |
abx250919-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Pig Protein BTG3 (BTG3) ELISA Kit |
abx517017-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Protein BTG3 (BTG3) ELISA Kit |
abx517018-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Protein BTG3 (BTG3) ELISA Kit |
abx500340-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Protein BTG3(BTG3) ELISA kit |
E02P0800-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Protein BTG3(BTG3) ELISA kit |
E02P0800-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Protein BTG3(BTG3) ELISA kit |
E02P0800-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein BTG3(BTG3) ELISA kit |
E03P0800-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein BTG3(BTG3) ELISA kit |
E03P0800-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Protein BTG3(BTG3) ELISA kit |
E03P0800-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Protein BTG3(BTG3) ELISA kit |
E04P0800-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Protein BTG3(BTG3) ELISA kit |
E04P0800-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Protein BTG3(BTG3) ELISA kit |
E04P0800-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Protein BTG3(BTG3) ELISA kit |
E06P0800-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Protein BTG3(BTG3) ELISA kit |
E06P0800-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Protein BTG3(BTG3) ELISA kit |
E06P0800-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Protein BTG3(BTG3) ELISA kit |
E07P0800-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Protein BTG3(BTG3) ELISA kit |
E07P0800-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Protein BTG3(BTG3) ELISA kit |
E07P0800-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Protein BTG3(BTG3) ELISA kit |
E08P0800-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Protein BTG3(BTG3) ELISA kit |
E08P0800-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Protein BTG3(BTG3) ELISA kit |
E08P0800-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Protein BTG3(BTG3) ELISA kit |
E09P0800-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Protein BTG3(BTG3) ELISA kit |
E09P0800-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Protein BTG3(BTG3) ELISA kit |
E09P0800-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Btg3/ Protein BTG3 ELISA Kit |
E0188Mo |
Sunlong |
1 Kit |
EUR 632 |
BANP ELISA Kit| Bovine Protein BANP ELISA Kit |
EF011803 |
Lifescience Market |
96 Tests |
EUR 689 |
Guinea pig Protein BTG3(BTG3) ELISA kit |
E05P0800-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Protein BTG3(BTG3) ELISA kit |
E05P0800-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Protein BTG3(BTG3) ELISA kit |
E05P0800-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Protein BTG3 (BTG3) Antibody |
20-abx006733 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Protein BTG3 (BTG3) Antibody |
abx026996-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protein BTG3 (BTG3) Antibody |
abx026996-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protein BTG3 (BTG3) Antibody |
20-abx339731 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELISA kit for Human Protein BTG3 |
EK3430 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein BTG3 in samples from serum, plasma, tissue homogenates and other biological fluids. |
BANP ELISA Kit (Human) (OKCD09208) |
OKCD09208 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: BTG3 associated nuclear protein;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL |
BANP ELISA Kit (Human) (OKDD00146) |
OKDD00146 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL |
BTG3 ELISA Kit (Human) (OKEH02362) |
OKEH02362 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein might play a role in neurogenesis in the central nervous system. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15 pg/mL |
BANP Recombinant Protein (Human) |
RP002620 |
ABM |
100 ug |
Ask for price |
BTG3 Recombinant Protein (Human) |
RP003271 |
ABM |
100 ug |
Ask for price |
BTG3 ELISA Kit (Mouse) (OKEH05483) |
OKEH05483 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Overexpression impairs serum-induced cell cycle progression from the G0/G1 to S phase. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
BTG3 ELISA Kit (Pig) (OKEH08035) |
OKEH08035 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Germinal-Center Associated Nuclear Protein (GANP) ELISA Kit |
abx595247-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Human Rheumatoid arthritis associated nuclear artigen ELISA kit |
E01R0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Rheumatoid arthritis associated nuclear artigen ELISA kit |
E01R0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Rheumatoid arthritis associated nuclear artigen ELISA kit |
E01R0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human rheumatoid arthritis associated nuclear artigen ELISA Kit |
ELA-E0486h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Gem Nuclear Organelle Associated Protein 2 (SIP1) ELISA Kit |
abx383207-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
BANP siRNA |
20-abx908877 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BANP siRNA |
20-abx908878 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BANP Antibody |
25189-100ul |
SAB |
100ul |
EUR 390 |
BANP antibody |
70R-15961 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal BANP antibody |
BANP Antibody |
DF12849 |
Affbiotech |
200ul |
EUR 304 |
Description: BANP Antibody detects endogenous levels of BANP. |
BANP Antibody |
1-CSB-PA002555GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against BANP. Recognizes BANP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
BANP Antibody |
1-CSB-PA854079ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against BANP. Recognizes BANP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
anti-BANP |
YF-PA19487 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to BANP |
anti-BANP |
YF-PA19488 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to BANP |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
BANP Recombinant Protein (Rat) |
RP191867 |
ABM |
100 ug |
Ask for price |
BANP Recombinant Protein (Mouse) |
RP118724 |
ABM |
100 ug |
Ask for price |
BANP Recombinant Protein (Mouse) |
RP118727 |
ABM |
100 ug |
Ask for price |
BTG3 siRNA |
20-abx900690 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BTG3 siRNA |
20-abx909384 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BTG3 siRNA |
20-abx909385 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BTG3 Antibody |
35655-100ul |
SAB |
100ul |
EUR 252 |
BTG3 Antibody |
1-CSB-PA969912 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against BTG3. Recognizes BTG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
Human rheumatoid arthritis associated nuclear artigen(RANA)ELISA Kit |
GA-E0464HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human rheumatoid arthritis associated nuclear artigen(RANA)ELISA Kit |
GA-E0464HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human rheumatoid arthritis associated nuclear artigen,RANA ELISA Kit |
201-12-0448 |
SunredBio |
96 tests |
EUR 440 |
- This rheumatoid arthritis associated nuclear artigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human rheumatoid arthritis associated nuclear artigen(RANA)ELISA Kit |
QY-E02600 |
Qayee Biotechnology |
96T |
EUR 361 |
Human BANP shRNA Plasmid |
20-abx960369 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BTG3 Recombinant Protein (Rat) |
RP192542 |
ABM |
100 ug |
Ask for price |
BTG3 Recombinant Protein (Mouse) |
RP120095 |
ABM |
100 ug |
Ask for price |
Human BTG3 shRNA Plasmid |
20-abx957472 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat Rheumatoid arthritis associated nuclear artigen ELISA kit |
E02R0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rheumatoid arthritis associated nuclear artigen ELISA kit |
E02R0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Rheumatoid arthritis associated nuclear artigen ELISA kit |
E02R0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Rheumatoid arthritis associated nuclear artigen ELISA kit |
E03R0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Rheumatoid arthritis associated nuclear artigen ELISA kit |
E03R0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Rheumatoid arthritis associated nuclear artigen ELISA kit |
E03R0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Rheumatoid arthritis associated nuclear artigen ELISA kit |
E04R0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Rheumatoid arthritis associated nuclear artigen ELISA kit |
E04R0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Rheumatoid arthritis associated nuclear artigen ELISA kit |
E04R0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Rheumatoid arthritis associated nuclear artigen ELISA kit |
E06R0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Rheumatoid arthritis associated nuclear artigen ELISA kit |
E06R0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Rheumatoid arthritis associated nuclear artigen ELISA kit |
E06R0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Rheumatoid arthritis associated nuclear artigen ELISA kit |
E07R0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Rheumatoid arthritis associated nuclear artigen ELISA kit |
E07R0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Rheumatoid arthritis associated nuclear artigen ELISA kit |
E07R0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Rheumatoid arthritis associated nuclear artigen ELISA kit |
E08R0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Rheumatoid arthritis associated nuclear artigen ELISA kit |
E08R0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Rheumatoid arthritis associated nuclear artigen ELISA kit |
E08R0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Rheumatoid arthritis associated nuclear artigen ELISA kit |
E09R0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Rheumatoid arthritis associated nuclear artigen ELISA kit |
E09R0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Rheumatoid arthritis associated nuclear artigen ELISA kit |
E09R0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human LSM10, U7 Small Nuclear RNA Associated (LSM10) ELISA Kit |
abx388332-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human LSM11, U7 Small Nuclear RNA Associated (LSM11) ELISA Kit |
abx388333-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
anti- BANP antibody |
FNab00799 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:50-1:500
- Immunogen: BTG3 associated nuclear protein
- Uniprot ID: Q8N9N5
- Gene ID: 54971
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against BANP |
BANP Rabbit pAb |
A19475-100ul |
Abclonal |
100 ul |
Ask for price |
BANP Rabbit pAb |
A19475-200ul |
Abclonal |
200 ul |
Ask for price |
BANP Rabbit pAb |
A19475-20ul |
Abclonal |
20 ul |
Ask for price |
BANP Rabbit pAb |
A19475-50ul |
Abclonal |
50 ul |
EUR 308 |
BANP Rabbit pAb |
A7595-100ul |
Abclonal |
100 ul |
EUR 308 |
BANP Rabbit pAb |
A7595-200ul |
Abclonal |
200 ul |
EUR 459 |
BANP Rabbit pAb |
A7595-20ul |
Abclonal |
20 ul |
EUR 183 |
BANP Rabbit pAb |
A7595-50ul |
Abclonal |
50 ul |
EUR 223 |
BANP Polyclonal Antibody |
30977-100ul |
SAB |
100ul |
EUR 252 |
BANP Polyclonal Antibody |
30977-50ul |
SAB |
50ul |
EUR 187 |
BANP cloning plasmid |
CSB-CL854079HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1410
- Sequence: atgatgtcggaacacgacctggccgatgtggttcagattgcagtggaagacctgagccctgaccacccagttgttttggagaatcatgtagtgacagatgaagacgaacctgctttgaaacgccagcgactagaaatcaattgccaggatccatctataaagtcattcctgtatt
- Show more
|
Description: A cloning plasmid for the BANP gene. |
BANP Blocking Peptide |
DF12849-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-BANP antibody |
STJ29732 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-BANP antibody |
STJ11100668 |
St John's Laboratory |
50 µl |
EUR 287 |
Description: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
BTG3 Conjugated Antibody |
C35655 |
SAB |
100ul |
EUR 397 |
BTG3 Rabbit pAb |
A2669-100ul |
Abclonal |
100 ul |
EUR 308 |
BTG3 Rabbit pAb |
A2669-200ul |
Abclonal |
200 ul |
EUR 459 |
BTG3 Rabbit pAb |
A2669-20ul |
Abclonal |
20 ul |
Ask for price |
BTG3 Rabbit pAb |
A2669-50ul |
Abclonal |
50 ul |
EUR 223 |
BTG3 cloning plasmid |
CSB-CL622758HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 891
- Sequence: atgaagaatgaaattgctgccgttgtcttctttttcacaaggctagttcgaaaacatgataagttgaaaaaagaggcagttgagaggtttgctgagaaattgaccctaatacttcaagaaaaatataaaaatcactggtatccagaaaaaccatcgaaaggacaggcctacagatg
- Show more
|
Description: A cloning plasmid for the BTG3 gene. |
Anti-BTG3 antibody |
STJ22843 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein might play a role in neurogenesis in the central nervous system. Two transcript variants encoding different isoforms have been found for this gene. |
BANP ORF Vector (Human) (pORF) |
ORF000874 |
ABM |
1.0 ug DNA |
EUR 95 |
BANP Protein Vector (Human) (pPB-C-His) |
PV003493 |
ABM |
500 ng |
EUR 329 |
BANP Protein Vector (Human) (pPB-N-His) |
PV003494 |
ABM |
500 ng |
EUR 329 |
BANP Protein Vector (Human) (pPM-C-HA) |
PV003495 |
ABM |
500 ng |
EUR 329 |
BANP Protein Vector (Human) (pPM-C-His) |
PV003496 |
ABM |
500 ng |
EUR 329 |
BANP Protein Vector (Human) (pPB-His-MBP) |
PV326250 |
ABM |
500 ng |
EUR 329 |
BANP Protein Vector (Human) (pPB-His-GST) |
PV326251 |
ABM |
500 ng |
EUR 329 |
Guinea pig Rheumatoid arthritis associated nuclear artigen ELISA kit |
E05R0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Rheumatoid arthritis associated nuclear artigen ELISA kit |
E05R0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Rheumatoid arthritis associated nuclear artigen ELISA kit |
E05R0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
BTG3 ORF Vector (Human) (pORF) |
ORF001091 |
ABM |
1.0 ug DNA |
EUR 95 |
BTG3 Protein Vector (Human) (pPB-C-His) |
PV004361 |
ABM |
500 ng |
EUR 329 |
BTG3 Protein Vector (Human) (pPB-N-His) |
PV004362 |
ABM |
500 ng |
EUR 329 |
BTG3 Protein Vector (Human) (pPM-C-HA) |
PV004363 |
ABM |
500 ng |
EUR 329 |
BTG3 Protein Vector (Human) (pPM-C-His) |
PV004364 |
ABM |
500 ng |
EUR 329 |
BTG3 Protein Vector (Human) (pPB-His-MBP) |
PV327858 |
ABM |
500 ng |
EUR 329 |
BTG3 Protein Vector (Human) (pPB-His-GST) |
PV327859 |
ABM |
500 ng |
EUR 329 |
Human LSM8 Homolog, U6 Small Nuclear RNA Associated (LSM8) ELISA Kit |
abx388339-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Nuclear Receptor 2C2-Associated Protein (NR2C2AP) Antibody |
abx146318-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Germinal-Center Associated Nuclear Protein (GANP) Antibody |
20-abx013088 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Nuclear Pore Associated Protein 1 (NPAP1) Antibody |
20-abx339916 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Pore Associated Protein 1 (NPAP1) Antibody |
20-abx339917 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit