
Human brain gene expression atlas project

Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit

Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

RDR-BANP-Hu-48Tests 48 Tests
EUR 544

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

RDR-BANP-Hu-96Tests 96 Tests
EUR 756

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

RD-BANP-Hu-48Tests 48 Tests
EUR 521

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

RD-BANP-Hu-96Tests 96 Tests
EUR 723

Human BTG3 Associated Nuclear Protein (BANP)ELISA Kit

201-12-2851 96 tests
EUR 440
  • This BTG3 Associated Nuclear Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

abx252071-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit

EH2692 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8N9N5
  • Alias: BANP/BEND1/SMAR1/Scaffold/matrix-associated region-1-binding protein/BEN domain-containing protein 1/Btg3-associated nuclear protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human BTG3 Associated Nuclear Protein(BANP)ELISA Kit

QY-E05109 96T
EUR 400

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

SEJ564Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

SEJ564Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

SEJ564Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

SEJ564Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human BTG3 Associated Nuclear Protein (BANP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human BTG3 Associated Nuclear Protein (BANP) in Tissue homogenates and other biological fluids.

Human BTG3 Associated Nuclear Protein (BANP) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as BTG3 Associated Nuclear Protein elisa. Alternative names of the recognized antigen: SMAR1
  • BEND1
  • BEN Domain Containing 1
  • Scaffold/matrix-associated region-1-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human BTG3 Associated Nuclear Protein (BANP) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

BTG3 Associated Nuclear Protein (BANP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

BTG3 Associated Nuclear Protein (BANP) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

BTG3 Associated Nuclear Protein (BANP) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

BTG3 Associated Nuclear Protein (BANP) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

BTG3 Associated Nuclear Protein (BANP) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

BTG3 Associated Nuclear Protein (BANP) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

BTG3 Associated Nuclear Protein (BANP) Antibody

abx230799-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human BTG3 Associated Nuclear Protein (BANP) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pig BTG3 Associated Nuclear Protein (BANP) ELISA Kit

abx360616-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse BTG3 Associated Nuclear Protein (BANP) ELISA Kit

abx392280-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Monkey BTG3 Associated Nuclear Protein (BANP) ELISA Kit

abx358944-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken BTG3 Associated Nuclear Protein (BANP) ELISA Kit

abx355576-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit BTG3 Associated Nuclear Protein (BANP) ELISA Kit

abx363558-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human BTG3 Associated Nuclear Protein (BANP) CLIA Kit

abx196493-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human BTG3 Associated Nuclear Protein (BANP) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human BANP (BTG3 Associated Nuclear Protein)

E-EL-H2430 1 plate of 96 wells
EUR 534
  • Gentaur's BANP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human BANP. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human BANP (BTG3 Associated Nuclear Protein) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human BANP (BTG3 Associated Nuclear Protein)

ELK3666 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to BTG3 Associated Nuclear Protein (BANP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of BTG3 Associated Nuclear Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig BTG3 Associated Nuclear Protein (BANP) ELISA Kit

abx357232-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CLIA kit for Human BANP (BTG3 Associated Nuclear Protein)

E-CL-H1430 1 plate of 96 wells
EUR 584
  • Gentaur's BANP CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human BANP . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human BANP (BTG3 Associated Nuclear Protein) in samples from Serum, Plasma, Cell supernatant


ELI-23978h 96 Tests
EUR 824

Human BTG3/ Protein BTG3 ELISA Kit

E0301Hu 1 Kit
EUR 605

Human Protein BTG3(BTG3) ELISA kit

E01P0800-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein BTG3(BTG3) ELISA kit

E01P0800-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein BTG3(BTG3) ELISA kit

E01P0800-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein BTG3 (BTG3) ELISA Kit

abx250919-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human BTG3(Protein BTG3) ELISA Kit

EH1626 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: Q14201
  • Alias: BTG3/Protein BTG3/Protein Tob5/Abundant in neuroepithelium area protein/BTG family member 3/ANA/TOB5/TOB55/TOFA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Protein BTG3, BTG3 ELISA KIT

ELI-33291h 96 Tests
EUR 824

Mouse Protein BANP, Banp ELISA KIT

ELI-34748m 96 Tests
EUR 865


ELI-49628b 96 Tests
EUR 928

Mouse Btg3/ Protein BTG3 ELISA Kit

E0188Mo 1 Kit
EUR 632

Rabbit Protein BTG3(BTG3) ELISA kit

E04P0800-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein BTG3(BTG3) ELISA kit

E04P0800-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein BTG3(BTG3) ELISA kit

E04P0800-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein BTG3(BTG3) ELISA kit

E02P0800-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein BTG3(BTG3) ELISA kit

E02P0800-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein BTG3(BTG3) ELISA kit

E02P0800-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein BTG3(BTG3) ELISA kit

E03P0800-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein BTG3(BTG3) ELISA kit

E03P0800-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein BTG3(BTG3) ELISA kit

E03P0800-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein BTG3(BTG3) ELISA kit

E06P0800-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein BTG3(BTG3) ELISA kit

E06P0800-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein BTG3(BTG3) ELISA kit

E06P0800-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein BTG3(BTG3) ELISA kit

E08P0800-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein BTG3(BTG3) ELISA kit

E08P0800-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein BTG3(BTG3) ELISA kit

E08P0800-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein BTG3(BTG3) ELISA kit

E07P0800-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein BTG3(BTG3) ELISA kit

E07P0800-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein BTG3(BTG3) ELISA kit

E07P0800-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein BTG3(BTG3) ELISA kit

E09P0800-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein BTG3(BTG3) ELISA kit

E09P0800-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein BTG3(BTG3) ELISA kit

E09P0800-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Protein BTG3, BTG3 ELISA KIT

ELI-11196p 96 Tests
EUR 928

Mouse Protein BTG3, Btg3 ELISA KIT

ELI-25358m 96 Tests
EUR 865

Pig Protein BTG3 (BTG3) ELISA Kit

abx517017-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Protein BTG3 (BTG3) ELISA Kit

abx517018-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Protein BTG3 (BTG3) ELISA Kit

abx500340-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Banp ELISA Kit| Mouse Protein BANP ELISA Kit

EF015964 96 Tests
EUR 689

BANP ELISA Kit| Bovine Protein BANP ELISA Kit

EF011803 96 Tests
EUR 689

Btg3 ELISA Kit| Rat Protein BTG3 ELISA Kit

EF018397 96 Tests
EUR 689

Btg3 ELISA Kit| Mouse Protein BTG3 ELISA Kit

EF014349 96 Tests
EUR 689

Btg3/ Rat Btg3 ELISA Kit

ELI-25127r 96 Tests
EUR 886

Guinea pig Protein BTG3(BTG3) ELISA kit

E05P0800-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein BTG3(BTG3) ELISA kit

E05P0800-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein BTG3(BTG3) ELISA kit

E05P0800-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Protein BTG3(BTG3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


EF006633 96 Tests
EUR 689

Human BTG3 ELISA Kit

ELA-E14584h 96 Tests
EUR 824


EF005776 96 Tests
EUR 689

Protein BTG3 (BTG3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein BTG3 (BTG3) Antibody

abx026996-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein BTG3 (BTG3) Antibody

abx026996-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein BTG3 (BTG3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Human Protein BTG3

EK3430 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein BTG3 in samples from serum, plasma, tissue homogenates and other biological fluids.

BANP ELISA Kit (Human) (OKCD09208)

OKCD09208 96 Wells
EUR 975
Description: Description of target: BTG3 associated nuclear protein;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

BANP ELISA Kit (Human) (OKDD00146)

OKDD00146 96 Wells
EUR 975
Description: Description of target: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

BTG3 ELISA Kit (Human) (OKEH02362)

OKEH02362 96 Wells
EUR 779
Description: Description of target: The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein might play a role in neurogenesis in the central nervous system. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15 pg/mL

BANP Recombinant Protein (Human)

RP002620 100 ug Ask for price

BTG3 Recombinant Protein (Human)

RP003271 100 ug Ask for price

BTG3 ELISA Kit (Mouse) (OKEH05483)

OKEH05483 96 Wells
EUR 779
Description: Description of target: Overexpression impairs serum-induced cell cycle progression from the G0/G1 to S phase. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

BTG3 ELISA Kit (Pig) (OKEH08035)

OKEH08035 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Germinal-Center Associated Nuclear Protein (GANP) ELISA Kit

abx595247-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Rheumatoid arthritis associated nuclear artigen ELISA kit

E01R0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Rheumatoid arthritis associated nuclear artigen ELISA kit

E01R0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Rheumatoid arthritis associated nuclear artigen ELISA kit

E01R0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human rheumatoid arthritis associated nuclear artigen ELISA Kit

ELA-E0486h 96 Tests
EUR 824

Human Gem Nuclear Organelle Associated Protein 2 (SIP1) ELISA Kit

abx383207-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

BANP Antibody

25189-100ul 100ul
EUR 390

BANP antibody

70R-15961 50 ul
EUR 435
Description: Rabbit polyclonal BANP antibody

BANP Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BANP. Recognizes BANP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BANP Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BANP. Recognizes BANP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

BANP Antibody

DF12849 200ul
EUR 304
Description: BANP Antibody detects endogenous levels of BANP.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19487 50 ul
EUR 363
Description: Mouse polyclonal to BANP


YF-PA19488 50 ug
EUR 363
Description: Mouse polyclonal to BANP

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

BTG3 Antibody

35655-100ul 100ul
EUR 252

BTG3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BTG3. Recognizes BTG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BANP Recombinant Protein (Mouse)

RP118724 100 ug Ask for price

BANP Recombinant Protein (Mouse)

RP118727 100 ug Ask for price

BANP Recombinant Protein (Rat)

RP191867 100 ug Ask for price

Human rheumatoid arthritis associated nuclear artigen,RANA ELISA Kit

201-12-0448 96 tests
EUR 440
  • This rheumatoid arthritis associated nuclear artigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human rheumatoid arthritis associated nuclear artigen(RANA)ELISA Kit

GA-E0464HM-48T 48T
EUR 289

Human rheumatoid arthritis associated nuclear artigen(RANA)ELISA Kit

GA-E0464HM-96T 96T
EUR 466

Human rheumatoid arthritis associated nuclear artigen(RANA)ELISA Kit

QY-E02600 96T
EUR 361

Human BANP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BTG3 Recombinant Protein (Rat)

RP192542 100 ug Ask for price

BTG3 Recombinant Protein (Mouse)

RP120095 100 ug Ask for price

Human BTG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rabbit Rheumatoid arthritis associated nuclear artigen ELISA kit

E04R0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Rheumatoid arthritis associated nuclear artigen ELISA kit

E04R0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Rheumatoid arthritis associated nuclear artigen ELISA kit

E04R0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rheumatoid arthritis associated nuclear artigen ELISA kit

E02R0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rheumatoid arthritis associated nuclear artigen ELISA kit

E02R0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Rheumatoid arthritis associated nuclear artigen ELISA kit

E02R0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Rheumatoid arthritis associated nuclear artigen ELISA kit

E03R0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Rheumatoid arthritis associated nuclear artigen ELISA kit

E03R0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Rheumatoid arthritis associated nuclear artigen ELISA kit

E03R0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Rheumatoid arthritis associated nuclear artigen ELISA kit

E06R0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Rheumatoid arthritis associated nuclear artigen ELISA kit

E06R0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Rheumatoid arthritis associated nuclear artigen ELISA kit

E06R0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Rheumatoid arthritis associated nuclear artigen ELISA kit

E08R0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Rheumatoid arthritis associated nuclear artigen ELISA kit

E08R0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Rheumatoid arthritis associated nuclear artigen ELISA kit

E08R0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Rheumatoid arthritis associated nuclear artigen ELISA kit

E09R0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Rheumatoid arthritis associated nuclear artigen ELISA kit

E09R0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Rheumatoid arthritis associated nuclear artigen ELISA kit

E09R0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Rheumatoid arthritis associated nuclear artigen ELISA kit

E07R0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Rheumatoid arthritis associated nuclear artigen ELISA kit

E07R0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Rheumatoid arthritis associated nuclear artigen ELISA kit

E07R0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human LSM10, U7 Small Nuclear RNA Associated (LSM10) ELISA Kit

abx388332-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human LSM11, U7 Small Nuclear RNA Associated (LSM11) ELISA Kit

abx388333-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

BANP Polyclonal Antibody

30977-100ul 100ul
EUR 252

BANP Polyclonal Antibody

30977-50ul 50ul
EUR 187

BANP Blocking Peptide

DF12849-BP 1mg
EUR 195

BANP cloning plasmid

CSB-CL854079HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atgatgtcggaacacgacctggccgatgtggttcagattgcagtggaagacctgagccctgaccacccagttgttttggagaatcatgtagtgacagatgaagacgaacctgctttgaaacgccagcgactagaaatcaattgccaggatccatctataaagtcattcctgtatt
  • Show more
Description: A cloning plasmid for the BANP gene.

BANP Rabbit pAb

A7595-100ul 100 ul
EUR 308

BANP Rabbit pAb

A7595-200ul 200 ul
EUR 459

BANP Rabbit pAb

A7595-20ul 20 ul
EUR 183

BANP Rabbit pAb

A7595-50ul 50 ul
EUR 223

BANP Rabbit pAb

A19475-100ul 100 ul Ask for price

BANP Rabbit pAb

A19475-200ul 200 ul Ask for price

BANP Rabbit pAb

A19475-20ul 20 ul Ask for price

BANP Rabbit pAb

A19475-50ul 50 ul
EUR 308

anti- BANP antibody

FNab00799 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: BTG3 associated nuclear protein
  • Uniprot ID: Q8N9N5
  • Gene ID: 54971
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against BANP

Anti-BANP antibody

PAab00799 100 ug
EUR 386

Anti-BANP antibody

STJ11100668 50 µl
EUR 287
Description: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-BANP antibody

STJ29732 100 µl
EUR 277
Description: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

BTG3 Conjugated Antibody

C35655 100ul
EUR 397

BTG3 cloning plasmid

CSB-CL622758HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 891
  • Sequence: atgaagaatgaaattgctgccgttgtcttctttttcacaaggctagttcgaaaacatgataagttgaaaaaagaggcagttgagaggtttgctgagaaattgaccctaatacttcaagaaaaatataaaaatcactggtatccagaaaaaccatcgaaaggacaggcctacagatg
  • Show more
Description: A cloning plasmid for the BTG3 gene.

BTG3 Rabbit pAb

A2669-100ul 100 ul
EUR 308

BTG3 Rabbit pAb

A2669-200ul 200 ul
EUR 459

BTG3 Rabbit pAb

A2669-20ul 20 ul Ask for price

BTG3 Rabbit pAb

A2669-50ul 50 ul
EUR 223

Anti-BTG3 antibody

STJ22843 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein might play a role in neurogenesis in the central nervous system. Two transcript variants encoding different isoforms have been found for this gene.

BANP ORF Vector (Human) (pORF)

ORF000874 1.0 ug DNA
EUR 95

BANP Protein Vector (Human) (pPB-His-MBP)

PV326250 500 ng
EUR 329

BANP Protein Vector (Human) (pPB-His-GST)

PV326251 500 ng
EUR 329

BANP Protein Vector (Human) (pPB-C-His)

PV003493 500 ng
EUR 329

BANP Protein Vector (Human) (pPB-N-His)

PV003494 500 ng
EUR 329

BANP Protein Vector (Human) (pPM-C-HA)

PV003495 500 ng
EUR 329

BANP Protein Vector (Human) (pPM-C-His)

PV003496 500 ng
EUR 329

Guinea pig Rheumatoid arthritis associated nuclear artigen ELISA kit

E05R0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Rheumatoid arthritis associated nuclear artigen ELISA kit

E05R0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Rheumatoid arthritis associated nuclear artigen ELISA kit

E05R0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Rheumatoid arthritis associated nuclear artigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

BTG3 ORF Vector (Human) (pORF)

ORF001091 1.0 ug DNA
EUR 95

BTG3 Protein Vector (Human) (pPB-His-MBP)

PV327858 500 ng
EUR 329

BTG3 Protein Vector (Human) (pPB-His-GST)

PV327859 500 ng
EUR 329

BTG3 Protein Vector (Human) (pPB-C-His)

PV004361 500 ng
EUR 329

BTG3 Protein Vector (Human) (pPB-N-His)

PV004362 500 ng
EUR 329

BTG3 Protein Vector (Human) (pPM-C-HA)

PV004363 500 ng
EUR 329

BTG3 Protein Vector (Human) (pPM-C-His)

PV004364 500 ng
EUR 329

Human LSM8 Homolog, U6 Small Nuclear RNA Associated (LSM8) ELISA Kit

abx388339-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Nuclear Receptor 2C2-Associated Protein (NR2C2AP) Antibody

abx146318-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Germinal-Center Associated Nuclear Protein (GANP) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Nuclear Pore Associated Protein 1 (NPAP1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Pore Associated Protein 1 (NPAP1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human BANP(BTG3 Associated Nuclear Protein) ELISA Kit