Human CCNA1(Cyclin A1) ELISA Kit
Human Cyclin A1 (CCNA1) ELISA Kit |
RD-CCNA1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cyclin A1 (CCNA1) ELISA Kit |
RD-CCNA1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Cyclin A1(CCNA1) ELISA kit |
E01C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cyclin A1(CCNA1) ELISA kit |
E01C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cyclin A1(CCNA1) ELISA kit |
E01C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Cyclin A1 (CCNA1) ELISA Kit |
20-abx151219 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Cyclin A1 (CCNA1) ELISA Kit |
abx571366-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Cyclin A1 ELISA Kit (CCNA1) |
RK01052 |
Abclonal |
96 Tests |
EUR 521 |
Human Cyclin A1 (CCNA1) ELISA Kit |
SED263Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cyclin A1 (CCNA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cyclin A1 (CCNA1) in Tissue homogenates and other biological fluids. |
Human Cyclin A1 (CCNA1) ELISA Kit |
SED263Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cyclin A1 (CCNA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cyclin A1 (CCNA1) in Tissue homogenates and other biological fluids. |
Human Cyclin A1 (CCNA1) ELISA Kit |
SED263Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cyclin A1 (CCNA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cyclin A1 (CCNA1) in Tissue homogenates and other biological fluids. |
Human Cyclin A1 (CCNA1) ELISA Kit |
SED263Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cyclin A1 (CCNA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cyclin A1 (CCNA1) in Tissue homogenates and other biological fluids. |
Human Cyclin A1 (CCNA1) ELISA Kit |
4-SED263Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Cyclin A1 elisa. Alternative names of the recognized antigen: CCN-A1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cyclin A1 (CCNA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Cyclin A1(CCNA1) ELISA kit |
E02C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cyclin A1(CCNA1) ELISA kit |
E02C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Cyclin A1(CCNA1) ELISA kit |
E02C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cyclin A1(CCNA1) ELISA kit |
E06C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cyclin A1(CCNA1) ELISA kit |
E06C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cyclin A1(CCNA1) ELISA kit |
E06C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cyclin A1(CCNA1) ELISA kit |
E04C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cyclin A1(CCNA1) ELISA kit |
E04C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cyclin A1(CCNA1) ELISA kit |
E04C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cyclin A1(CCNA1) ELISA kit |
E03C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cyclin A1(CCNA1) ELISA kit |
E03C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cyclin A1(CCNA1) ELISA kit |
E03C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cyclin A1(CCNA1) ELISA kit |
E07C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cyclin A1(CCNA1) ELISA kit |
E07C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Cyclin A1(CCNA1) ELISA kit |
E07C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cyclin A1(CCNA1) ELISA kit |
E09C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cyclin A1(CCNA1) ELISA kit |
E09C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Cyclin A1(CCNA1) ELISA kit |
E09C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cyclin A1(CCNA1) ELISA kit |
E08C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cyclin A1(CCNA1) ELISA kit |
E08C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Cyclin A1(CCNA1) ELISA kit |
E08C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Cyclin A1 (CCNA1) ELISA Kit |
abx353180-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Rat Cyclin A1 (CCNA1) ELISA Kit |
abx354064-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Cyclin A1 (CCNA1) Antibody |
20-abx004306 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Antibody |
abx038161-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Antibody |
20-abx128311 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cyclin A1 (CCNA1) Antibody |
20-abx171970 |
Abbexa |
|
|
|
Cyclin A1 (Ccna1) Antibody |
abx030955-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Cyclin A1 (Ccna1) Antibody |
abx030955-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Antibody |
20-abx241137 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Antibody |
abx331501-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Antibody |
abx331560-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Antibody |
20-abx328776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Antibody |
20-abx333989 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Cyclin A1 (CCNA1) |
4-RPD263Hu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P78396
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 58.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Cyclin A1 expressed in: E.coli |
Recombinant Cyclin A1 (CCNA1) |
4-RPD263Hu02 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P78396
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 56kDa
- Isoelectric Point: 4.7
|
Description: Recombinant Human Cyclin A1 expressed in: E.coli |
ELISA kit for Human CCNA1 (Cyclin-A1) |
E-EL-H2334 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's CCNA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CCNA1. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human CCNA1 (Cyclin-A1) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human CCNA1 (Cyclin A1) |
ELK4081 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cyclin A1 (CCNA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cyclin A1 (CCNA1
- Show more
|
Description: A sandwich ELISA kit for detection of Cyclin A1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Cyclin A1 (CCNA1) CLIA Kit |
20-abx494175 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Cyclin A1 (CCNA1) Protein |
20-abx166947 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Mouse CCNA1 (Cyclin-A1) |
E-EL-M1295 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's CCNA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CCNA1. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse CCNA1 (Cyclin-A1) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Rat CCNA1 (Cyclin-A1) |
E-EL-R1221 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's CCNA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CCNA1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rat CCNA1 (Cyclin-A1) in samples from Serum, Plasma, Cell supernatant |
Guinea pig Cyclin A1(CCNA1) ELISA kit |
E05C1444-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Cyclin A1(CCNA1) ELISA kit |
E05C1444-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Cyclin A1(CCNA1) ELISA kit |
E05C1444-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Cyclin A1 (CCNA1) Antibody (HRP) |
20-abx335220 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Antibody (FITC) |
20-abx335221 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Antibody (Biotin) |
20-abx335222 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Cyclin A1/CCNA1 Antibody |
PB9485 |
BosterBio |
100ug/vial |
EUR 294 |
Human Cyclin-A1 Isoform 2 (CCNA1) |
1-CSB-BP004804HU |
Cusabio |
-
EUR 661.00
-
EUR 276.00
-
EUR 1669.00
-
EUR 885.00
-
EUR 1221.00
-
EUR 381.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 54.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Cyclin-A1 Isoform 2(CCNA1),partial expressed in Baculovirus |
Cyclin A1 (CCNA1) Polyclonal Antibody (Human) |
4-PAD263Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1) |
Cyclin A1/2 (CCNA1/2) Antibody |
20-abx008474 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Cyclin A1 (CCNA1) Polyclonal Antibody (Human), APC |
4-PAD263Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with APC. |
Cyclin A1 (CCNA1) Polyclonal Antibody (Human), Biotinylated |
4-PAD263Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with Biotin. |
Cyclin A1 (CCNA1) Polyclonal Antibody (Human), Cy3 |
4-PAD263Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with Cy3. |
Cyclin A1 (CCNA1) Polyclonal Antibody (Human), FITC |
4-PAD263Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with FITC. |
Cyclin A1 (CCNA1) Polyclonal Antibody (Human), HRP |
4-PAD263Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with HRP. |
Cyclin A1 (CCNA1) Polyclonal Antibody (Human), PE |
4-PAD263Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with PE. |
Polyclonal CCNA1 / Cyclin A1 Antibody (aa411-460) |
APR02868G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCNA1 / Cyclin A1 (aa411-460). This antibody is tested and proven to work in the following applications: |
Cyclin A1 (CCNA1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD263Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with APC-Cy7. |
Cyclin A1 (Cyclin A1) Antibody |
20-abx116790 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cyclin A1 (Cyclin A1) Antibody |
abx038316-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Cyclin A1 (Cyclin A1) Antibody |
20-abx134059 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Cyclin A1 (Cyclin A1) Antibody |
20-abx013053 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Cyclin A1 (Cyclin A1) Antibody |
abx232120-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Cyclin A1 Cell ELISA Kit |
abx595159-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Cyclin A1 antibody |
70R-31153 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal Cyclin A1 antibody |
Cyclin A1 Antibody |
33350-100ul |
SAB |
100ul |
EUR 252 |
Cyclin A1 Antibody |
33350-50ul |
SAB |
50ul |
EUR 187 |
Cyclin A1+ Cyclin A2 Antibody |
49194-100ul |
SAB |
100ul |
EUR 333 |
Cyclin A1+ Cyclin A2 Antibody |
49194-50ul |
SAB |
50ul |
EUR 239 |
Cyclin A1 antibody |
70R-51682 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal Cyclin A1 antibody |
Cyclin A1 Antibody |
AF0143 |
Affbiotech |
200ul |
EUR 304 |
Description: Cyclin A1 antibody detects endogenous levels of total Cyclin A1. |
Cyclin A1 Antibody |
AF5313 |
Affbiotech |
200ul |
EUR 304 |
Description: Cyclin A1 Antibody detects endogenous levels of total Cyclin A1. |
anti-Cyclin A1 |
YF-PA25230 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Cyclin A1 |
CCNA1 ELISA Kit (Human) (OKAN04882) |
OKAN04882 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.049 ng/mL |
CCNA1 ELISA Kit (Human) (OKCD00374) |
OKCD00374 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May be involved in the control of the cell cycle at the G1/S (start) and G2/M (mitosis) transitions. May primarily function in the control of the germline meiotic cell cycle and additionally in the control of mitotic cell cycle in some somatic cells.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Functions of cyclin A1 in the cell cycle and its interactions with transcription factor E2F-1 and the Rb family of proteins."_x005F_x005F_x000D_Yang R., Mueller C., Huynh V., Fung Y.K., Yee A.S., Koeffler H.P._x005F_x005F_x000D_Mol. Cell. Biol. 19:2400-2407(1999) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.049 ng/mL |
CCNA1 ELISA Kit (Human) (OKEH07531) |
OKEH07531 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.069ng/mL |
Cyclin A1 Colorimetric Cell-Based ELISA Kit |
EKC1151 |
BosterBio |
100ul |
EUR 572 |
Cyclin A1+ Cyclin A2 Conjugated Antibody |
C49194 |
SAB |
100ul |
EUR 397 |
Cyclin A1 Polyclonal Antibody |
40801-100ul |
SAB |
100ul |
EUR 252 |
Cyclin A1 Polyclonal Antibody |
40801-50ul |
SAB |
50ul |
EUR 187 |
Polyclonal Cyclin A1 Antibody |
APR05503G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cyclin A1 . This antibody is tested and proven to work in the following applications: |
Anti-Cyclin A1 Antibody |
A03889-2 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for Cyclin A1 Antibody (CCNA1) detection.tested for WB in Human, Mouse, Rat. |
Cyclin A1/2 antibody |
70R-50654 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal Cyclin A1/2 antibody |
Cyclin A1 Blocking Peptide |
20-abx162225 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cyclin A1 Blocking Peptide |
AF0143-BP |
Affbiotech |
1mg |
EUR 195 |
Cyclin A1 Blocking Peptide |
AF5313-BP |
Affbiotech |
1mg |
EUR 195 |
Cyclin A1 Conjugated Antibody |
C33350 |
SAB |
100ul |
EUR 397 |
Cyclin A1 Polyclonal Antibody |
ABP51080-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of Cyclin A1 from Human, Mouse, Rat. This Cyclin A1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460 |
Cyclin A1 Polyclonal Antibody |
ABP51080-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of Cyclin A1 from Human, Mouse, Rat. This Cyclin A1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460 |
Cyclin A1 Polyclonal Antibody |
ABP51080-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of Cyclin A1 from Human, Mouse, Rat. This Cyclin A1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460 |
Cyclin A1 Polyclonal Antibody |
ES2079-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Cyclin A1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Cyclin A1 Polyclonal Antibody |
ES2079-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Cyclin A1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
anti- Cyclin A1 antibody |
FNab02120 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:20-1:200
- Immunogen: cyclin A1
- Uniprot ID: P78396
- Gene ID: 8900
- Research Area: Cancer, Cell Division and Proliferation, Neuroscience
|
Description: Antibody raised against Cyclin A1 |
Anti-Cyclin A1 antibody |
STJ92533 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Cyclin A1. |
Cyclin A1 Colorimetric Cell-Based ELISA Kit (OKAG00649) |
OKAG00649 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity: |
CCNA1 ELISA Kit (Mouse) (OKEI00580) |
OKEI00580 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: May be involved in the control of the cell cycle at the G1/S (start) and G2/M (mitosis) transitions. May primarily function in the control of the germline meiotic cell cycle and additionally in the control of mitotic cell cycle in some somatic cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL |
CCNA1 ELISA Kit (Rat) (OKEI00890) |
OKEI00890 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: May be involved in the control of the cell cycle at the G1/S (start) and G2/M (mitosis) transitions. May primarily function in the control of the germline meiotic cell cycle and additionally in the control of mitotic cell cycle in some somatic cells.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
Cyclin A1 / 2 Blocking Peptide |
20-abx063529 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-Cyclin A1 (4A11-5B5) |
YF-MA16598 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cyclin A1 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human apoprotein A1,apo-A1 ELISA Kit |
201-12-1536 |
SunredBio |
96 tests |
EUR 440 |
- This apoprotein A1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human apolipoprotein A1 (Apo-A1) ELISA Kit |
CSB-E08103h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human apolipoprotein A1 (Apo-A1) ELISA Kit |
1-CSB-E08103h |
Cusabio |
-
EUR 657.00
-
EUR 4484.00
-
EUR 2384.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human apoprotein A1,apo-A1 ELISA Kit |
CN-03325H1 |
ChemNorm |
96T |
EUR 451 |
Human apoprotein A1,apo-A1 ELISA Kit |
CN-03325H2 |
ChemNorm |
48T |
EUR 300 |
Human apoprotein A1(apo-A1)ELISA Kit |
GA-E1552HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human apoprotein A1(apo-A1)ELISA Kit |
GA-E1552HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
CCNA1 Antibody |
31063-100ul |
SAB |
100ul |
EUR 252 |
CCNA1 Antibody |
31063-50ul |
SAB |
50ul |
EUR 187 |
CCNA1 antibody |
70R-16228 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CCNA1 antibody |
CCNA1 Antibody |
32936-100ul |
SAB |
100ul |
EUR 252 |
CCNA1 Antibody |
42702-100ul |
SAB |
100ul |
EUR 252 |
CCNA1 Antibody |
1-CSB-PA004804GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CCNA1 Antibody |
1-CSB-PA004804LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CCNA1 Antibody |
1-CSB-PA001859 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000 |
CCNA1 Antibody |
CSB-PA068470- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
CCNA1 Antibody |
CSB-PA068470-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
CCNA1 Antibody |
1-CSB-PA078687 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100 |
CCNA1 Antibody |
CSB-PA574179- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
CCNA1 Antibody |
CSB-PA574179-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
CCNA1 siRNA |
20-abx900875 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCNA1 siRNA |
20-abx910807 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCNA1 siRNA |
20-abx910808 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CCNA1 |
YF-PA27423 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CCNA1 |
Cyclin A1/A2 recombinant monoclonal antibody |
A5190 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human Cyclin A1/A2 for WB,ELISA |
Human CCNA1 shRNA Plasmid |
20-abx955885 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CCNA1 Recombinant Protein (Human) |
RP006145 |
ABM |
100 ug |
Ask for price |
ELISA kit for Human apolipoprotein A1 (Apo-A1) |
EK0171 |
SAB |
96 tests |
EUR 779 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates and other biological fluids. |
ES Electrophoresis Casting Tray, 7cm X 14cm |
LE1011-A1 |
GenDepot |
Ea |
EUR 165 |
Anti-Cyclin A1/A2 Rabbit Monoclonal Antibody |
M00700 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Cyclin A1/A2 Antibody. Validated in IP, WB and tested in Human. |
Anti-Cyclin A Antibody (monoclonal, CY-A1) |
MA1032 |
BosterBio |
100ug/vial |
EUR 294 |
Human Ephrin A1 ELISA kit |
E01E0042-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ephrin A1 ELISA kit |
E01E0042-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ephrin A1 ELISA kit |
E01E0042-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Annexin A1 ELISA kit |
E01A0208-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Annexin A1 ELISA kit |
E01A0208-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apolipoprotein A1 ELISA kit |
E01A0509-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apolipoprotein A1 ELISA kit |
E01A0509-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Apolipoprotein A1 ELISA kit |
E01A0509-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human a1 microglobulin ELISA kit |
E01A0689-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human a1 microglobulin ELISA kit |
E01A0689-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human a1 microglobulin ELISA kit |
E01A0689-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Immunoglobulin A1 ELISA kit |
E01I0016-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Immunoglobulin A1 ELISA kit |
E01I0016-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Immunoglobulin A1 ELISA kit |
E01I0016-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phospholipase A1 ELISA kit |
E01P0124-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phospholipase A1 ELISA kit |
E01P0124-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phospholipase A1 ELISA kit |
E01P0124-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human A1-AGP ELISA Kit |
EHA0695 |
Abclonal |
96Tests |
EUR 521 |
Human A1-MG ELISA Kit |
EHA0696 |
Abclonal |
96Tests |
EUR 521 |
Human Apo-A1 ELISA Kit |
EHA0851 |
Abclonal |
96Tests |
EUR 521 |
CCNA1 Rabbit pAb |
A14529-100ul |
Abclonal |
100 ul |
EUR 308 |
CCNA1 Rabbit pAb |
A14529-200ul |
Abclonal |
200 ul |
EUR 459 |
CCNA1 Rabbit pAb |
A14529-20ul |
Abclonal |
20 ul |
EUR 183 |
CCNA1 Rabbit pAb |
A14529-50ul |
Abclonal |
50 ul |
EUR 223 |
CCNA1/CCNA2 Antibody |
1-CSB-PA001857 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CCNA1/CCNA2. Recognizes CCNA1/CCNA2 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
CCNA1 Conjugated Antibody |
C32936 |
SAB |
100ul |
EUR 397 |
CCNA1 Conjugated Antibody |
C31063 |
SAB |
100ul |
EUR 397 |
CCNA1 / CCNA2 Antibody |
20-abx330041 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCNA1 cloning plasmid |
CSB-CL004804HU-10ug |
Cusabio |
10ug |
EUR 500 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1395
- Sequence: atggagaccggctttcccgcaatcatgtaccctggatcttttattgggggctggggagaagagtatctcagctgggaaggaccggggctcccagatttcgtcttccagcagcccgtggagtctgaagcaatgcactgcagcaaccccaagagtggagttgtgctggctacagtgg
- Show more
|
Description: A cloning plasmid for the CCNA1 gene. |
CCNA1 Rabbit pAb |
A5631-100ul |
Abclonal |
100 ul |
EUR 308 |
CCNA1 Rabbit pAb |
A5631-200ul |
Abclonal |
200 ul |
EUR 459 |
CCNA1 Rabbit pAb |
A5631-20ul |
Abclonal |
20 ul |
EUR 183 |
CCNA1 Rabbit pAb |
A5631-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-CCNA1 antibody |
STJ27598 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-CCNA1 antibody |
STJ116740 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene. |
Human anti-apolipoprotein A1 antibody,Apo A1 ELISA Kit |
201-12-0481 |
SunredBio |
96 tests |
EUR 440 |
- This anti-apolipoprotein A1 antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Apolipoprotein A1 precursor,Pre-Apo-A1 ELISA kit |
201-12-1401 |
SunredBio |
96 tests |
EUR 440 |
- This Apolipoprotein A1 precursor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human anti-apolipoprotein A1(Apo-A1)antibody ELISA kit |
E01A2043-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human anti-apolipoprotein A1(Apo-A1)antibody ELISA kit |
E01A2043-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human CCNA1(Cyclin A1) ELISA Kit