
Human brain gene expression atlas project

Human CCNA1(Cyclin A1) ELISA Kit

Human CCNA1(Cyclin A1) ELISA Kit

Human Cyclin A1 (CCNA1) ELISA Kit

RD-CCNA1-Hu-48Tests 48 Tests
EUR 521

Human Cyclin A1 (CCNA1) ELISA Kit

RD-CCNA1-Hu-96Tests 96 Tests
EUR 723

Human Cyclin A1(CCNA1) ELISA kit

E01C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin A1(CCNA1) ELISA kit

E01C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin A1(CCNA1) ELISA kit

E01C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cyclin A1 (CCNA1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cyclin- A1, CCNA1 ELISA KIT

ELI-25474h 96 Tests
EUR 824

Human Cyclin A1 (CCNA1) ELISA Kit

abx571366-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Cyclin A1(CCNA1)ELISA Kit

QY-E00944 96T
EUR 361

Human Cyclin A1 ELISA Kit (CCNA1)

RK01052 96 Tests
EUR 521

Human Cyclin A1 (CCNA1) ELISA Kit

SED263Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cyclin A1 (CCNA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cyclin A1 (CCNA1) in Tissue homogenates and other biological fluids.

Human Cyclin A1 (CCNA1) ELISA Kit

SED263Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cyclin A1 (CCNA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cyclin A1 (CCNA1) in Tissue homogenates and other biological fluids.

Human Cyclin A1 (CCNA1) ELISA Kit

SED263Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cyclin A1 (CCNA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cyclin A1 (CCNA1) in Tissue homogenates and other biological fluids.

Human Cyclin A1 (CCNA1) ELISA Kit

SED263Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cyclin A1 (CCNA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cyclin A1 (CCNA1) in Tissue homogenates and other biological fluids.

Human Cyclin A1 (CCNA1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cyclin A1 elisa. Alternative names of the recognized antigen: CCN-A1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cyclin A1 (CCNA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Cyclin A1(CCNA1) ELISA kit

E02C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin A1(CCNA1) ELISA kit

E02C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cyclin A1(CCNA1) ELISA kit

E02C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin A1(CCNA1) ELISA kit

E06C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin A1(CCNA1) ELISA kit

E06C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cyclin A1(CCNA1) ELISA kit

E06C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin A1(CCNA1) ELISA kit

E04C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin A1(CCNA1) ELISA kit

E04C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cyclin A1(CCNA1) ELISA kit

E04C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin A1(CCNA1) ELISA kit

E03C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin A1(CCNA1) ELISA kit

E03C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin A1(CCNA1) ELISA kit

E03C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin A1(CCNA1) ELISA kit

E07C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin A1(CCNA1) ELISA kit

E07C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cyclin A1(CCNA1) ELISA kit

E07C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin A1(CCNA1) ELISA kit

E09C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin A1(CCNA1) ELISA kit

E09C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cyclin A1(CCNA1) ELISA kit

E09C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin A1(CCNA1) ELISA kit

E08C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin A1(CCNA1) ELISA kit

E08C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cyclin A1(CCNA1) ELISA kit

E08C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cyclin A1 (CCNA1) ELISA Kit

abx353180-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Cyclin A1 (CCNA1) ELISA Kit

abx354064-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse Cyclin- A1, Ccna1 ELISA KIT

ELI-33084m 96 Tests
EUR 865

Cyclin A1 (CCNA1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Antibody

abx038161-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cyclin A1 (CCNA1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cyclin A1 (Ccna1) Antibody

abx030955-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cyclin A1 (Ccna1) Antibody

abx030955-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Antibody

abx331501-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Antibody

abx331560-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Cyclin A1 (CCNA1)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P78396
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Cyclin A1 expressed in: E.coli

Recombinant Cyclin A1 (CCNA1)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P78396
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56kDa
  • Isoelectric Point: 4.7
Description: Recombinant Human Cyclin A1 expressed in: E.coli

ELISA kit for Human CCNA1 (Cyclin-A1)

E-EL-H2334 1 plate of 96 wells
EUR 534
  • Gentaur's CCNA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CCNA1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CCNA1 (Cyclin-A1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human CCNA1 (Cyclin A1)

ELK4081 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cyclin A1 (CCNA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cyclin A1 (CCNA1
  • Show more
Description: A sandwich ELISA kit for detection of Cyclin A1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cyclin A1 (CCNA1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Cyclin A1 (CCNA1) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse CCNA1 (Cyclin-A1)

E-EL-M1295 1 plate of 96 wells
EUR 534
  • Gentaur's CCNA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CCNA1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CCNA1 (Cyclin-A1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat CCNA1 (Cyclin-A1)

E-EL-R1221 1 plate of 96 wells
EUR 534
  • Gentaur's CCNA1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat CCNA1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat CCNA1 (Cyclin-A1) in samples from Serum, Plasma, Cell supernatant

Guinea pig Cyclin A1(CCNA1) ELISA kit

E05C1444-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cyclin A1(CCNA1) ELISA kit

E05C1444-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cyclin A1(CCNA1) ELISA kit

E05C1444-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Cyclin A1(CCNA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cyclin A1 (CCNA1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Cyclin A1/CCNA1 Antibody

PB9485 100ug/vial
EUR 294

Human Cyclin-A1 Isoform 2 (CCNA1)

  • EUR 661.00
  • EUR 276.00
  • EUR 1669.00
  • EUR 885.00
  • EUR 1221.00
  • EUR 381.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cyclin-A1 Isoform 2(CCNA1),partial expressed in Baculovirus

Cyclin A1 (CCNA1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1)

Cyclin A1/2 (CCNA1/2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cyclin A1 (CCNA1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with APC.

Cyclin A1 (CCNA1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with Biotin.

Cyclin A1 (CCNA1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with Cy3.

Cyclin A1 (CCNA1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with FITC.

Cyclin A1 (CCNA1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with HRP.

Cyclin A1 (CCNA1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with PE.

Polyclonal CCNA1 / Cyclin A1 Antibody (aa411-460)

APR02868G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CCNA1 / Cyclin A1 (aa411-460). This antibody is tested and proven to work in the following applications:

Cyclin A1 (CCNA1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCNA1 (Ser183~Tyr430)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Cyclin A1 (CCNA1). This antibody is labeled with APC-Cy7.

Cyclin A1 ELISA KIT|Human

EF008941 96 Tests
EUR 689

Cyclin A1 (Cyclin A1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cyclin A1 (Cyclin A1) Antibody

abx038316-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cyclin A1 (Cyclin A1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cyclin A1 (Cyclin A1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Cyclin A1 (Cyclin A1) Antibody

abx232120-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Cyclin A1 Cell ELISA Kit

abx595159-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Ccna1/ Rat Ccna1 ELISA Kit

ELI-25475r 96 Tests
EUR 886

Cyclin A1+ Cyclin A2 Antibody

49194-100ul 100ul
EUR 333

Cyclin A1+ Cyclin A2 Antibody

49194-50ul 50ul
EUR 239

Cyclin A1 antibody

70R-31153 100 ug
EUR 327
Description: Rabbit polyclonal Cyclin A1 antibody

Cyclin A1 Antibody

33350-100ul 100ul
EUR 252

Cyclin A1 Antibody

33350-50ul 50ul
EUR 187

Cyclin A1 antibody

70R-51682 100 ul
EUR 244
Description: Purified Polyclonal Cyclin A1 antibody

Cyclin A1 Antibody

AF0143 200ul
EUR 304
Description: Cyclin A1 antibody detects endogenous levels of total Cyclin A1.

Cyclin A1 Antibody

AF5313 200ul
EUR 304
Description: Cyclin A1 Antibody detects endogenous levels of total Cyclin A1.

Cyclin A1 Antibody

ABF5313 100 ug
EUR 438

Cyclin A1 Antibody

ABF0143 100 ug
EUR 438

anti-Cyclin A1

YF-PA25230 50 ul
EUR 334
Description: Mouse polyclonal to Cyclin A1

CCNA1 ELISA Kit (Human) (OKAN04882)

OKAN04882 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.049 ng/mL

CCNA1 ELISA Kit (Human) (OKCD00374)

OKCD00374 96 Wells
EUR 831
Description: Description of target: May be involved in the control of the cell cycle at the G1/S (start) and G2/M (mitosis) transitions. May primarily function in the control of the germline meiotic cell cycle and additionally in the control of mitotic cell cycle in some somatic cells.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.8"Functions of cyclin A1 in the cell cycle and its interactions with transcription factor E2F-1 and the Rb family of proteins."_x005F_x005F_x000D_Yang R., Mueller C., Huynh V., Fung Y.K., Yee A.S., Koeffler H.P._x005F_x005F_x000D_Mol. Cell. Biol. 19:2400-2407(1999) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.049 ng/mL

CCNA1 ELISA Kit (Human) (OKEH07531)

OKEH07531 96 Wells
EUR 896
Description: Description of target: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.069ng/mL

Cyclin A1 Colorimetric Cell-Based ELISA Kit

EKC1151 100ul
EUR 572

Cyclin A1+ Cyclin A2 Conjugated Antibody

C49194 100ul
EUR 397

Cyclin A1 Polyclonal Antibody

40801-100ul 100ul
EUR 252

Cyclin A1 Polyclonal Antibody

40801-50ul 50ul
EUR 187

Polyclonal Cyclin A1 Antibody

APR05503G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cyclin A1 . This antibody is tested and proven to work in the following applications:

Anti-Cyclin A1 Antibody

A03889-2 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Cyclin A1 Antibody (CCNA1) detection.tested for WB in Human, Mouse, Rat.

Cyclin A1/2 antibody

70R-50654 100 ul
EUR 244
Description: Purified Polyclonal Cyclin A1/2 antibody

Cyclin A1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Cyclin A1 Blocking Peptide

AF0143-BP 1mg
EUR 195

Cyclin A1 Blocking Peptide

AF5313-BP 1mg
EUR 195

Cyclin A1 Conjugated Antibody

C33350 100ul
EUR 397

Cyclin A1 Polyclonal Antibody

ABP51080-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of Cyclin A1 from Human, Mouse, Rat. This Cyclin A1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460

Cyclin A1 Polyclonal Antibody

ABP51080-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of Cyclin A1 from Human, Mouse, Rat. This Cyclin A1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460

Cyclin A1 Polyclonal Antibody

ABP51080-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of Cyclin A1 from Human, Mouse, Rat. This Cyclin A1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Cyclin A1 at AA range: 380-460

Cyclin A1 Polyclonal Antibody

ES2079-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cyclin A1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Cyclin A1 Polyclonal Antibody

ES2079-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cyclin A1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

anti- Cyclin A1 antibody

FNab02120 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: cyclin A1
  • Uniprot ID: P78396
  • Gene ID: 8900
  • Research Area: Cancer, Cell Division and Proliferation, Neuroscience
Description: Antibody raised against Cyclin A1

Anti-Cyclin A1 antibody

PAab02120 100 ug
EUR 355

Anti-Cyclin A1 antibody

STJ92533 200 µl
EUR 197
Description: Rabbit polyclonal to Cyclin A1.

Cyclin A1 Colorimetric Cell-Based ELISA Kit (OKAG00649)

OKAG00649 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

CCNA1 ELISA Kit (Mouse) (OKEI00580)

OKEI00580 96 Wells
EUR 767
Description: Description of target: May be involved in the control of the cell cycle at the G1/S (start) and G2/M (mitosis) transitions. May primarily function in the control of the germline meiotic cell cycle and additionally in the control of mitotic cell cycle in some somatic cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL

CCNA1 ELISA Kit (Rat) (OKEI00890)

OKEI00890 96 Wells
EUR 767
Description: Description of target: May be involved in the control of the cell cycle at the G1/S (start) and G2/M (mitosis) transitions. May primarily function in the control of the germline meiotic cell cycle and additionally in the control of mitotic cell cycle in some somatic cells.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Cyclin A1 / 2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

pCMV-HA-Cyclin A1 Plasmid

PVTB00631-2a 2 ug
EUR 356

Anti-Cyclin A1 (4A11-5B5)

YF-MA16598 100 ug
EUR 363
Description: Mouse monoclonal to Cyclin A1

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human apoprotein A1,apo-A1 ELISA Kit

201-12-1536 96 tests
EUR 440
  • This apoprotein A1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human apolipoprotein A1 (Apo-A1) ELISA Kit

CSB-E08103h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human apolipoprotein A1 (Apo-A1) ELISA Kit

  • EUR 657.00
  • EUR 4484.00
  • EUR 2384.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, cell culture supernates, saliva, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human apoprotein A1,apo-A1 ELISA Kit

CN-03325H1 96T
EUR 451

Human apoprotein A1,apo-A1 ELISA Kit

CN-03325H2 48T
EUR 300

Human apoprotein A1(apo-A1)ELISA Kit

GA-E1552HM-48T 48T
EUR 289

Human apoprotein A1(apo-A1)ELISA Kit

GA-E1552HM-96T 96T
EUR 466

Human apoprotein A1(apo-A1)ELISA Kit

QY-E00339 96T
EUR 394

CCNA1 Antibody

31063-100ul 100ul
EUR 252

CCNA1 Antibody

31063-50ul 50ul
EUR 187

CCNA1 antibody

70R-16228 50 ul
EUR 435
Description: Rabbit polyclonal CCNA1 antibody

CCNA1 Antibody

32936-100ul 100ul
EUR 252

CCNA1 Antibody

42702-100ul 100ul
EUR 252

CCNA1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CCNA1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CCNA1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

CCNA1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCNA1 Antibody

CSB-PA068470-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCNA1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100

CCNA1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500

CCNA1 Antibody

CSB-PA574179-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCNA1. Recognizes CCNA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27423 50 ug
EUR 363
Description: Mouse polyclonal to CCNA1

Cyclin A1/A2 recombinant monoclonal antibody

A5190 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Cyclin A1/A2 for WB,ELISA

Human CCNA1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCNA1 Recombinant Protein (Human)

RP006145 100 ug Ask for price

ELISA kit for Human apolipoprotein A1 (Apo-A1)

EK0171 96 tests
EUR 779
Description: Enzyme-linked immunosorbent assay kit for quantification of Human apolipoprotein A1 (Apo-A1) in samples from serum, plasma, tissue homogenates and other biological fluids.

ES Electrophoresis Casting Tray, 7cm X 14cm

LE1011-A1 Ea
EUR 165

Anti-Cyclin A1/A2 Rabbit Monoclonal Antibody

M00700 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cyclin A1/A2 Antibody. Validated in IP, WB and tested in Human.

Anti-Cyclin A Antibody (monoclonal, CY-A1)

MA1032 100ug/vial
EUR 294

Human Apolipoprotein A1 ELISA Kit

E-80AP1 1 x 96 well plate
EUR 370

Human Ephrin A1 ELISA kit

E01E0042-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ephrin A1 ELISA kit

E01E0042-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ephrin A1 ELISA kit

E01E0042-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A1 ELISA kit

E01A0208-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Annexin A1 ELISA kit

E01A0208-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Annexin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apolipoprotein A1 ELISA kit

E01A0509-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apolipoprotein A1 ELISA kit

E01A0509-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apolipoprotein A1 ELISA kit

E01A0509-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Apolipoprotein A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human a1 microglobulin ELISA kit

E01A0689-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human a1 microglobulin ELISA kit

E01A0689-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human a1 microglobulin ELISA kit

E01A0689-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human a1 microglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Immunoglobulin A1 ELISA kit

E01I0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Immunoglobulin A1 ELISA kit

E01I0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Immunoglobulin A1 ELISA kit

E01I0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Immunoglobulin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipase A1 ELISA kit

E01P0124-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipase A1 ELISA kit

E01P0124-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospholipase A1 ELISA kit

E01P0124-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phospholipase A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human A1-AGP ELISA Kit

EHA0695 96Tests
EUR 521

Human A1-MG ELISA Kit

EHA0696 96Tests
EUR 521

Human Apo-A1 ELISA Kit

EHA0851 96Tests
EUR 521

Carboxypeptidase A1 ELISA KIT|Human

EF008381 96 Tests
EUR 689

CCNA1 Rabbit pAb

A14529-100ul 100 ul
EUR 308

CCNA1 Rabbit pAb

A14529-200ul 200 ul
EUR 459

CCNA1 Rabbit pAb

A14529-20ul 20 ul
EUR 183

CCNA1 Rabbit pAb

A14529-50ul 50 ul
EUR 223

CCNA1/CCNA2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCNA1/CCNA2. Recognizes CCNA1/CCNA2 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

CCNA1 Conjugated Antibody

C32936 100ul
EUR 397

CCNA1 Conjugated Antibody

C31063 100ul
EUR 397

CCNA1 / CCNA2 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CCNA1 cloning plasmid

CSB-CL004804HU-10ug 10ug
EUR 500
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1395
  • Sequence: atggagaccggctttcccgcaatcatgtaccctggatcttttattgggggctggggagaagagtatctcagctgggaaggaccggggctcccagatttcgtcttccagcagcccgtggagtctgaagcaatgcactgcagcaaccccaagagtggagttgtgctggctacagtgg
  • Show more
Description: A cloning plasmid for the CCNA1 gene.

CCNA1 Rabbit pAb

A5631-100ul 100 ul
EUR 308

CCNA1 Rabbit pAb

A5631-200ul 200 ul
EUR 459

CCNA1 Rabbit pAb

A5631-20ul 20 ul
EUR 183

CCNA1 Rabbit pAb

A5631-50ul 50 ul
EUR 223

Anti-CCNA1 antibody

STJ27598 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CCNA1 antibody

STJ116740 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene.

Human anti-apolipoprotein A1 antibody,Apo A1 ELISA Kit

201-12-0481 96 tests
EUR 440
  • This anti-apolipoprotein A1 antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Apolipoprotein A1 precursor,Pre-Apo-A1 ELISA kit

201-12-1401 96 tests
EUR 440
  • This Apolipoprotein A1 precursor ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human anti-apolipoprotein A1(Apo-A1)antibody ELISA kit

E01A2043-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human anti-apolipoprotein A1(Apo-A1)antibody ELISA kit

E01A2043-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human anti-apolipoprotein A1(Apo-A1)antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CCNA1(Cyclin A1) ELISA Kit