Human FLCN(Folliculin) ELISA Kit

Human FLCN(Folliculin) ELISA Kit

Human Folliculin (FLCN) ELISA Kit

RDR-FLCN-Hu-96Tests 96 Tests
EUR 756

Human Folliculin, FLCN ELISA KIT

ELI-26737h 96 Tests
EUR 824

Human Folliculin (FLCN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Folliculin(FLCN) ELISA kit

CSB-EL008711HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Folliculin (FLCN) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Folliculin(FLCN) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Folliculin(FLCN) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Folliculin (FLCN) ELISA Kit

SEJ102Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit

SEJ102Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit

SEJ102Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit

SEJ102Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Folliculin (FLCN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Folliculin (FLCN) in Tissue homogenates and other biological fluids.

Human Folliculin (FLCN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Folliculin elisa. Alternative names of the recognized antigen: BHD
  • FLCL
  • BHD skin lesion fibrofolliculoma protein
  • Birt-Hogg-Dube syndrome protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Folliculin (FLCN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Bovine Folliculin, FLCN ELISA KIT

ELI-32494b 96 Tests
EUR 928

Mouse Folliculin, Flcn ELISA KIT

ELI-32528m 96 Tests
EUR 865

Mouse Folliculin (FLCN) ELISA Kit

abx389320-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Folliculin (FLCN) ELISA Kit

abx391347-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Folliculin (FLCN) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Folliculin (FLCN) Antibody

abx034049-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

abx034049-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Folliculin (FLCN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Folliculin (FLCN) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Folliculin (FLCN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Folliculin (FLCN) Antibody

abx233157-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ELISA kit for Human FLCN (Folliculin)

ELK3954 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Folliculin (FLCN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Folliculin (FLCN
  • Show more
Description: A sandwich ELISA kit for detection of Folliculin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Folliculin (FLCN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Folliculin (FLCN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Flcn ELISA Kit| Rat Folliculin ELISA Kit

EF018702 96 Tests
EUR 689

Flcn ELISA Kit| Mouse Folliculin ELISA Kit

EF014951 96 Tests
EUR 689

FLCN ELISA Kit| Bovine Folliculin ELISA Kit

EF011395 96 Tests
EUR 689

Folliculin (FLCN) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Flcn/ Rat Flcn ELISA Kit

ELI-26711r 96 Tests
EUR 886


EF009648 96 Tests
EUR 689

FLCN ELISA Kit (Human) (OKCD01982)

OKCD01982 96 Wells
EUR 831
Description: Description of target: May be a tumor suppressor. May be involved in energy and/or nutrient sensing through the AMPK and mTOR signaling pathways. May regulate phosphorylation of RPS6KB1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

FLCN ELISA Kit (Human) (OKCA02102)

OKCA02102 96 Wells
EUR 833
Description: Description of target: May be a tumor suppressor. May be involved in energy and/or nutrient sensing through the AMPK and mTOR signaling pathways. May regulate phosphorylation of RPS6KB1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

Recombinant human FLCN

P1429 100ug Ask for price
  • Uniprot ID: Q8NFG4
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human FLCN

Human Folliculin- interacting protein 1, FNIP1 ELISA KIT

ELI-09886h 96 Tests
EUR 824

Human Folliculin- interacting protein 2, FNIP2 ELISA KIT

ELI-27534h 96 Tests
EUR 824

Human Folliculin Interacting Protein 1 (FNIP1) ELISA Kit

abx387393-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FLCN Antibody

36486-100ul 100ul
EUR 252

FLCN antibody

38963-100ul 100ul
EUR 252

FLCN antibody

70R-17318 50 ul
EUR 435
Description: Rabbit polyclonal FLCN antibody

FLCN antibody

70R-10330 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FLCN antibody

FLCN antibody

70R-10331 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FLCN antibody

FLCN Antibody

DF12608 200ul
EUR 304
Description: FLCN Antibody detects endogenous levels of FLCN.

FLCN Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

FLCN Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

FLCN Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

FLCN Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FLCN. Recognizes FLCN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


YF-PA22691 50 ug
EUR 363
Description: Mouse polyclonal to FLCN


YF-PA26966 50 ul
EUR 334
Description: Mouse polyclonal to FLCN


YF-PA26967 50 ul
EUR 334
Description: Mouse polyclonal to FLCN

Human FLCN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FLCN Recombinant Protein (Human)

RP012259 100 ug Ask for price

Mouse Folliculin- interacting protein 1, Fnip1 ELISA KIT

ELI-27518m 96 Tests
EUR 865

Chicken Folliculin- interacting protein 1, FNIP1 ELISA KIT

ELI-32867c 96 Tests
EUR 928

Mouse Folliculin- interacting protein 2, Fnip2 ELISA KIT

ELI-47311m 96 Tests
EUR 865

FLCN Conjugated Antibody

C36486 100ul
EUR 397

FLCN cloning plasmid

CSB-CL008711HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1029
  • Sequence: atgaatgccatcgtggctctctgccacttctgcgagctccacggcccccgcactctcttctgcacggaggtgctgcacgccccacttcctcaaggggatgggaatgaggacagtcctggccagggtgagcaggcggaagaagaggaaggtggcattcagatgaacagtcggatgc
  • Show more
Description: A cloning plasmid for the FLCN gene.

anti- FLCN antibody

FNab03157 100µg
EUR 505.25
  • Immunogen: folliculin
  • Uniprot ID: Q8NFG4
  • Gene ID: 201163
  • Research Area: Cancer
Description: Antibody raised against FLCN

Anti-FLCN Antibody

A00718-1 100ug/vial
EUR 294

FLCN Rabbit pAb

A11849-100ul 100 ul
EUR 308

FLCN Rabbit pAb

A11849-200ul 200 ul
EUR 459

FLCN Rabbit pAb

A11849-20ul 20 ul Ask for price

FLCN Rabbit pAb

A11849-50ul 50 ul Ask for price

FLCN Rabbit pAb

A14521-100ul 100 ul
EUR 308

FLCN Rabbit pAb

A14521-200ul 200 ul
EUR 459

FLCN Rabbit pAb

A14521-20ul 20 ul
EUR 183

FLCN Rabbit pAb

A14521-50ul 50 ul
EUR 223

FLCN Rabbit pAb

A6493-100ul 100 ul
EUR 308

FLCN Rabbit pAb

A6493-200ul 200 ul
EUR 459

FLCN Rabbit pAb

A6493-20ul 20 ul
EUR 183

Human FLCN(Folliculin) ELISA Kit