
Human brain gene expression atlas project

Human FYN(FYN Oncogene Related To SRC/FGR/YES) ELISA Kit

Human FYN(FYN Oncogene Related To SRC/FGR/YES) ELISA Kit

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

RD-FYN-Hu-48Tests 48 Tests
EUR 521

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

RD-FYN-Hu-96Tests 96 Tests
EUR 723

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

RDR-FYN-Hu-48Tests 48 Tests
EUR 544

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

RDR-FYN-Hu-96Tests 96 Tests
EUR 756

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

DLR-FYN-Mu-48T 48T
EUR 527
  • Should the Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

DLR-FYN-Mu-96T 96T
EUR 688
  • Should the Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

RD-FYN-Mu-48Tests 48 Tests
EUR 533

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

RD-FYN-Mu-96Tests 96 Tests
EUR 740

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

RDR-FYN-Mu-48Tests 48 Tests
EUR 557

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

RDR-FYN-Mu-96Tests 96 Tests
EUR 774

FYN Oncogene Related To SRC/FGR/YES (FYN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

FYN Oncogene Related To SRC, FGR, YES (Fyn) Antibody

abx139461-01mg 0.1 mg
EUR 425
  • Shipped within 5-12 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx036746-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx033634-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx033634-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx033635-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx033635-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx012180-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx015866-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx028352-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx028352-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC/FGR/YES (FYN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

FYN Oncogene Related To SRC/FGR/YES (FYN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

FYN Oncogene Related To SRC/FGR/YES (FYN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC/FGR/YES (FYN) Antibody

abx331654-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

abx431263-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant FYN Oncogene Related To SRC/FGR/YES (FYN)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P06241
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 64.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human FYN Oncogene Related To SRC/FGR/YES expressed in: E.coli

FYN Oncogene Related To SRC, FGR, YES (FYN) ELISA Kit

abx595240-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human FYN Oncogene Related To SRC/FGR/YES (FYN) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human FYN Oncogene Related To SRC/FGR/YES ELISA Kit (FYN)

RK01429 96 Tests
EUR 521

Human FYN Oncogene Related To SRC/FGR/YES(FYN)ELISA Kit

QY-E04578 96T
EUR 361

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

SEK247Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human FYN Oncogene Related To SRC/FGR/YES (FYN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human FYN Oncogene Related To SRC/FGR/YES (FYN) in tissue homogenates, cell lysates and other biological fluids.

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

SEK247Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human FYN Oncogene Related To SRC/FGR/YES (FYN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human FYN Oncogene Related To SRC/FGR/YES (FYN) in tissue homogenates, cell lysates and other biological fluids.

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

SEK247Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human FYN Oncogene Related To SRC/FGR/YES (FYN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human FYN Oncogene Related To SRC/FGR/YES (FYN) in tissue homogenates, cell lysates and other biological fluids.

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

SEK247Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human FYN Oncogene Related To SRC/FGR/YES (FYN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human FYN Oncogene Related To SRC/FGR/YES (FYN) in tissue homogenates, cell lysates and other biological fluids.

Human FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as FYN Oncogene Related To SRC/FGR/YES elisa. Alternative names of the recognized antigen: SLK
  • SYN
  • c-Fyn
  • Src-like kinase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human FYN Oncogene Related To SRC/FGR/YES (FYN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC, FGR, YES (FYN) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse FYN Oncogene Related To SRC/FGR/YES ELISA Kit (FYN)

RK02826 96 Tests
EUR 521

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

SEK247Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

SEK247Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

SEK247Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

SEK247Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as FYN Oncogene Related To SRC/FGR/YES elisa. Alternative names of the recognized antigen: SLK
  • SYN
  • c-Fyn
  • Src-like kinase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human FYN Oncogene Related To SRC/FGR/YES (FYN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse FYN Oncogene Related To SRC/FGR/YES (FYN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human FYN (FYN Oncogene Related To SRC/FGR/YES)

ELK3670 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to FYN Oncogene Related To SRC/FGR/YES (FYN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of FYN Oncogene Related To SRC/FGR/YES from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

FYN Oncogene Related To SRC/FGR/YES (FYN) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FYN (Gly2~Leu537)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FYN Oncogene Related To SRC/FGR/YES (FYN)

ELISA kit for Mouse FYN (FYN Oncogene Related To SRC/FGR/YES)

ELK6319 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to FYN Oncogene Related To SRC/FGR/YES (FYN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of FYN Oncogene Related To SRC/FGR/YES from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

FYN Oncogene Related To SRC/FGR/YES (FYN) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FYN (Gly2~Leu537)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FYN Oncogene Related To SRC/FGR/YES (FYN). This antibody is labeled with APC.

FYN Oncogene Related To SRC/FGR/YES (FYN) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FYN (Gly2~Leu537)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FYN Oncogene Related To SRC/FGR/YES (FYN). This antibody is labeled with Biotin.

FYN Oncogene Related To SRC/FGR/YES (FYN) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FYN (Gly2~Leu537)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FYN Oncogene Related To SRC/FGR/YES (FYN). This antibody is labeled with Cy3.

FYN Oncogene Related To SRC/FGR/YES (FYN) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FYN (Gly2~Leu537)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FYN Oncogene Related To SRC/FGR/YES (FYN). This antibody is labeled with FITC.

FYN Oncogene Related To SRC/FGR/YES (FYN) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FYN (Gly2~Leu537)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FYN Oncogene Related To SRC/FGR/YES (FYN). This antibody is labeled with HRP.

FYN Oncogene Related To SRC/FGR/YES (FYN) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FYN (Gly2~Leu537)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FYN Oncogene Related To SRC/FGR/YES (FYN). This antibody is labeled with PE.

FYN Oncogene Related To SRC, FGR, YES Phospho-Tyr530 (FYN pY530) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC/FGR/YES Phospho-Tyr530 (FYN pY530) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

FYN Oncogene Related To SRC/FGR/YES (FYN) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FYN (Gly2~Leu537)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FYN Oncogene Related To SRC/FGR/YES (FYN). This antibody is labeled with APC-Cy7.

c-SRC / FYN / c-YES Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

c-SRC / FYN / c-YES Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Fyn/ Rat Fyn ELISA Kit

ELI-09878r 96 Tests
EUR 886

c-SRC/FYN/c-YES (phospho-Tyr419/420/426) Antibody

13302-100ul 100ul
EUR 252

c-SRC/FYN/c-YES (phospho-Tyr419/420/426) Conjugated Antibody

C13302 100ul
EUR 397

Fyn Related Kinase (FRK) ELISA Kit

abx595754-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Tyrosine protein kinase Fyn(FYN) ELISA kit

E01T0613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine protein kinase Fyn(FYN) ELISA kit

E01T0613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine protein kinase Fyn(FYN) ELISA kit

E01T0613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tyrosine- protein kinase Fyn, FYN ELISA KIT

ELI-27563h 96 Tests
EUR 824

Human Tyrosine-Protein Kinase Fyn (FYN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fyn Related Kinase (FRK) ELISA Kit

abx387420-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.


EF005017 96 Tests
EUR 689

Mouse Tyrosine protein kinase Fyn(FYN) ELISA kit

E03T0613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tyrosine protein kinase Fyn(FYN) ELISA kit

E03T0613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tyrosine protein kinase Fyn(FYN) ELISA kit

E03T0613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tyrosine protein kinase Fyn(FYN) ELISA kit

E02T0613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tyrosine protein kinase Fyn(FYN) ELISA kit

E02T0613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tyrosine protein kinase Fyn(FYN) ELISA kit

E02T0613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Fyn(FYN) ELISA kit

E04T0613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Fyn(FYN) ELISA kit

E04T0613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tyrosine protein kinase Fyn(FYN) ELISA kit

E04T0613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tyrosine protein kinase Fyn(FYN) ELISA kit

E08T0613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tyrosine protein kinase Fyn(FYN) ELISA kit

E08T0613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tyrosine protein kinase Fyn(FYN) ELISA kit

E08T0613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tyrosine protein kinase Fyn(FYN) ELISA kit

E07T0613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tyrosine protein kinase Fyn(FYN) ELISA kit

E07T0613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tyrosine protein kinase Fyn(FYN) ELISA kit

E07T0613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tyrosine protein kinase Fyn(FYN) ELISA kit

E06T0613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tyrosine protein kinase Fyn(FYN) ELISA kit

E06T0613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tyrosine protein kinase Fyn(FYN) ELISA kit

E06T0613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tyrosine protein kinase Fyn(FYN) ELISA kit

E09T0613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tyrosine protein kinase Fyn(FYN) ELISA kit

E09T0613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tyrosine protein kinase Fyn(FYN) ELISA kit

E09T0613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Tyrosine- protein kinase Fyn, FYN ELISA KIT

ELI-27562c 96 Tests
EUR 928

Mouse Tyrosine- protein kinase Fyn, Fyn ELISA KIT

ELI-37594m 96 Tests
EUR 865

Porcine Tyrosine- protein kinase Fyn, FYN ELISA KIT

ELI-47364p 96 Tests
EUR 928

Bovine Tyrosine- protein kinase Fyn, FYN ELISA KIT

ELI-30932b 96 Tests
EUR 928

Mouse Tyrosine-Protein Kinase Fyn (FYN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Tyrosine-Protein Kinase Fyn (FYN) ELISA Kit

abx391361-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Fyn Related Kinase (FRK) ELISA Kit

abx389359-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Fyn Related Kinase (FRK) ELISA Kit

abx391362-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Fyn Related Kinase (FRK) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fyn Related Kinase (FRK) Antibody

abx036406-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

abx033633-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

abx033633-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

abx011719-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

abx015865-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

abx028351-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

abx028351-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

abx332358-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fyn Related Kinase (FRK) Antibody

abx233224-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Fyn Related Kinase (FRK)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P42685
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.8KDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fyn Related Kinase expressed in: E.coli

Human Fyn Related Kinase (FRK) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fyn ELISA Kit| Rat Tyrosine-protein kinase Fyn ELISA Kit

EF018717 96 Tests
EUR 689

Fyn ELISA Kit| Mouse Tyrosine-protein kinase Fyn ELISA Kit

EF014990 96 Tests
EUR 689

FYN ELISA Kit| Bovine Tyrosine-protein kinase Fyn ELISA Kit

EF011407 96 Tests
EUR 689

FYN ELISA Kit| chicken Tyrosine-protein kinase Fyn ELISA Kit

EF012313 96 Tests
EUR 689

Guinea pig Tyrosine protein kinase Fyn(FYN) ELISA kit

E05T0613-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Tyrosine protein kinase Fyn(FYN) ELISA kit

E05T0613-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Tyrosine protein kinase Fyn(FYN) ELISA kit

E05T0613-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tyrosine protein kinase Fyn(FYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FYN ELISA Kit (Human) (OKCD00596)

OKCD00596 96 Wells
EUR 831
Description: Description of target: This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL

FYN ELISA Kit (Human) (OKAN04769)

OKAN04769 96 Wells
EUR 792
Description: Description of target: This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.060 ng/mL

Fyn Antibody

AF6102 200ul
EUR 304
Description: Fyn Antibody detects endogenous levels of total Fyn.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FYN Antibody

BF0309 200ul
EUR 376
Description: FYN antibody detects endogenous levels of total FYN.

Fyn Antibody

AF7697 200ul
EUR 376
Description: Fyn Antibody detects endogenous levels of Fyn.

Fyn Antibody

ABF6102 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FYN antibody

70R-49768 100 ul
EUR 287
Description: Purified Polyclonal FYN antibody

FYN antibody

70R-5772 50 ug
EUR 467
Description: Rabbit polyclonal FYN antibody raised against the N terminal of FYN

FYN antibody

70R-5867 50 ug
EUR 467
Description: Rabbit polyclonal FYN antibody raised against the middle region of FYN

FYN antibody

70R-31289 100 ug
EUR 327
Description: Rabbit polyclonal FYN antibody

FYN Antibody

43186-100ul 100ul
EUR 252

FYN antibody

10R-10608 100 ug
EUR 349
Description: Mouse monoclonal FYN antibody

FYN antibody

10R-11001 100 ug
EUR 349
Description: Mouse monoclonal FYN antibody

FYN Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FYN. Recognizes FYN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

FYN Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FYN. Recognizes FYN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FYN Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FYN. Recognizes FYN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

FYN Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FYN. Recognizes FYN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

FYN Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FYN. Recognizes FYN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000


YF-PA11887 50 ul
EUR 363
Description: Mouse polyclonal to Fyn


YF-PA11888 100 ug
EUR 403
Description: Rabbit polyclonal to Fyn


YF-PA23745 50 ul
EUR 334
Description: Mouse polyclonal to Fyn


YF-PA23746 50 ul
EUR 334
Description: Mouse polyclonal to Fyn

Recombinant Human FYN

P0305 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P06241
Description: Recombinant Human protein for FYN

Fyn Related Kinase (FRK) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FRK (Val234~Phe491)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fyn Related Kinase (FRK)

Monoclonal SYN / FYN Antibody (aa7-176, clone FYN-59), Clone: FYN-59

AMM01704G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human SYN / FYN (aa7-176, clone FYN-59). The antibodies are raised in Mouse and are from clone FYN-59. This antibody is applicable in WB and IHC-P, IP

Monoclonal SYN / FYN Antibody (aa7-176, clone FYN-01), Clone: FYN-01

AMM01732G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human SYN / FYN (aa7-176, clone FYN-01). The antibodies are raised in Mouse and are from clone FYN-01. This antibody is applicable in WB and IHC-P, ICC, IP

Fyn (pY530) Cell ELISA Kit

abx595997-296tests 2 × 96 tests
EUR 707
  • Shipped within 1-2 weeks.

Fyn ELISA Kit (Mouse) (OKCD02029)

OKCD02029 96 Wells
EUR 857
Description: Description of target: Non-receptor tyrosine-protein kinase that plays a role in many biological processes including regulation of cell growth and survival, cell adhesion, integrin-mediated signaling, cytoskeletal remodeling, cell motility, immune response and axon guidance. Inactive FYN is phosphorylated on its C-terminal tail within the catalytic domain. Following activation by PKA, the protein subsequently associates with PTK2/FAK1, allowing PTK2/FAK1 phosphorylation, activation and targeting to focal adhesions. Involved in the regulation of cell adhesion and motility through phosphorylation of CTNNB1 (beta-catenin) and CTNND1 (delta-catenin). Regulates cytoskeletal remodeling by phosphorylating several proteins including the actin regulator WAS and the microtubule-associated proteins MAP2 and MAPT. Promotes cell survival by phosphorylating AGAP2/PIKE-A and preventing its apoptotic cleavage. Participates in signal transduction pathways that regulate the integrity of the glomerular slit diaphragm (an essential part of the glomerular filter of the kidney) by phosphorylating several slit diaphragm components including NPHS1, KIRREL and TRPC6. Plays a role in neural processes by phosphorylating DPYSL2, a multifunctional adapter protein within the central nervous system, ARHGAP32, a regulator for Rho family GTPases implicated in various neural functions, and SNCA, a small pre-synaptic protein. Participates in the downstream signaling pathways that lead to T-cell differentiation and proliferation following T-cell receptor (TCR) stimulation. Also participates in negative feedback regulation of TCR signaling through phosphorylation of PAG1, thereby promoting interaction between PAG1 and CSK and recruitment of CSK to lipid rafts. CSK maintains LCK and FYN in an inactive form. Promotes CD28-induced phosphorylation of VAV1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

Fyn Blocking Peptide

AF6102-BP 1mg
EUR 195

FYN Conjugated Antibody

C43186 100ul
EUR 397

Monoclonal Fyn Antibody

AMM03159G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human Fyn. The antibodies are raised in Mouse. This antibody is applicable in WB, ICC

FYN Blocking Peptide

BF0309-BP 1mg
EUR 195

Fyn Blocking Peptide

AF7697-BP 1mg
EUR 195

FYN cloning plasmid

CSB-CL009101HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1449
  • Sequence: atgggctgtgtgcaatgtaaggataaagaagcaacaaaactgacggaggagagggacggcagcctgaaccagagctctgggtaccgctatggcacagaccccacccctcagcactaccccagcttcggtgtgacctccatccccaactacaacaacttccacgcagccgggggcc
  • Show more
Description: A cloning plasmid for the FYN gene.

Fyn Polyclonal Antibody

ES2382-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Fyn from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Fyn Polyclonal Antibody

ES2382-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Fyn from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Fyn Polyclonal Antibody

ES5416-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Fyn from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Fyn Polyclonal Antibody

ES5416-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Fyn from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FYN (pS21) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

FYN (pY416) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fyn Polyclonal Antibody

ABP51383-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530
  • Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530

Fyn Polyclonal Antibody

ABP51383-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530
  • Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530

Fyn Polyclonal Antibody

ABP51383-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530
  • Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y530

FYN (pT530) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fyn (pY530) Antibody

abx010767-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Fyn Polyclonal Antibody

ABP54417-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213
  • Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213

Fyn Polyclonal Antibody

ABP54417-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213
  • Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213

Fyn Polyclonal Antibody

ABP54417-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213
  • Applications tips:
Description: A polyclonal antibody for detection of Fyn from Human, Mouse, Rat. This Fyn antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Fyn around the non-phosphorylation site of Y213

FYN (pY530) Antibody

abx333497-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Fyn-p59 Protein

  • EUR 829.00
  • EUR 411.00
  • EUR 537.00
  • 10 ug
  • 2 µg
  • 5 ug
  • Shipped within 5-10 working days.

FYN Mouse mAb

A0086-100ul 100 ul
EUR 384

FYN Mouse mAb

A0086-200ul 200 ul
EUR 554

FYN Mouse mAb

A0086-20ul 20 ul Ask for price

FYN Mouse mAb

A0086-50ul 50 ul
EUR 265

FYN Polyclonal Antibody

A59178 100 µg
EUR 570.55
Description: The best epigenetics products

Fyn antibody (Tyr530)

70R-37433 100 ug
EUR 349
Description: Rabbit Polyclonal Fyn antibody (Tyr530)

FYN antibody (Tyr530)

70R-31288 100 ug
EUR 327
Description: Rabbit polyclonal FYN antibody (Tyr530)

FYN Mouse pAb

A18127-100ul 100 ul
EUR 308

Human FYN(FYN Oncogene Related To SRC/FGR/YES) ELISA Kit