Human GSS(Glutathione Synthetase) ELISA Kit

Human GSS(Glutathione Synthetase) ELISA Kit

Human Glutathione Synthetase (GSS) ELISA Kit
RDR-GSS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Glutathione Synthetase (GSS) ELISA Kit
RDR-GSS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Glutathione Synthetase (GSS) ELISA Kit
DLR-GSS-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Glutathione Synthetase (GSS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glutathione Synthetase (GSS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Glutathione Synthetase (GSS) ELISA Kit
DLR-GSS-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Glutathione Synthetase (GSS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glutathione Synthetase (GSS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Glutathione Synthetase (GSS) ELISA Kit
DLR-GSS-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Glutathione Synthetase (GSS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione Synthetase (GSS) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Glutathione Synthetase (GSS) ELISA Kit
DLR-GSS-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Glutathione Synthetase (GSS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione Synthetase (GSS) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Glutathione Synthetase (GSS) ELISA Kit
RD-GSS-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Glutathione Synthetase (GSS) ELISA Kit
RD-GSS-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Glutathione Synthetase (GSS) ELISA Kit
RD-GSS-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Glutathione Synthetase (GSS) ELISA Kit
RD-GSS-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Mouse Glutathione Synthetase (GSS) ELISA Kit
RDR-GSS-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Glutathione Synthetase (GSS) ELISA Kit
RDR-GSS-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Glutathione Synthetase (GSS) ELISA Kit
RDR-GSS-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Glutathione Synthetase (GSS) ELISA Kit
RDR-GSS-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Glutathione synthetase, GSS ELISA KIT
ELI-08507h	Lifescience Market	96 Tests	EUR 824

Human Glutathione synthetase (GSS) ELISA Kit
20-abx151755	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Glutathione synthetase(GSS) ELISA kit
CSB-EL009969HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Glutathione synthetase (GSS) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Glutathione synthetase(GSS) ELISA kit
1-CSB-EL009969HU	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Glutathione synthetase(GSS) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Glutathione Synthetase ELISA Kit (GSS)
RK01518	Abclonal	96 Tests	EUR 521

Human Glutathione Synthetase(GSS)ELISA Kit
QY-E03326	Qayee Biotechnology	96T	EUR 361

Human Glutathione Synthetase (GSS) ELISA Kit
SED757Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutathione Synthetase (GSS) in serum, plasma, tissue homogenates and other biological fluids.

Human Glutathione Synthetase (GSS) ELISA Kit
SED757Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutathione Synthetase (GSS) in serum, plasma, tissue homogenates and other biological fluids.

Human Glutathione Synthetase (GSS) ELISA Kit
SED757Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutathione Synthetase (GSS) in serum, plasma, tissue homogenates and other biological fluids.

Human Glutathione Synthetase (GSS) ELISA Kit
SED757Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glutathione Synthetase (GSS) in serum, plasma, tissue homogenates and other biological fluids.

Human Glutathione Synthetase (GSS) ELISA Kit
4-SED757Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glutathione Synthetase elisa. Alternative names of the recognized antigen: Glutathione synthase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glutathione Synthetase (GSS) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Glutathione Synthetase (GSS) Antibody
20-abx126925	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Glutathione Synthetase (GSS) Antibody
abx117027-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Glutathione Synthetase (GSS) Antibody
20-abx000992	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Glutathione Synthetase (GSS) Antibody
20-abx102149	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione Synthetase (GSS) Antibody
20-abx102150	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione Synthetase (GSS) Antibody
20-abx102151	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione Synthetase (GSS) Antibody
abx033048-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Glutathione Synthetase (GSS) Antibody
abx033048-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Glutathione Synthetase (GSS) Antibody
20-abx172622	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Glutathione Synthetase (GSS) Antibody
20-abx172623	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Glutathione Synthetase (GSS) Antibody
20-abx176663	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Glutathione Synthetase (GSS) Antibody
20-abx338660	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione Synthetase (GSS) Antibody
abx340201-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Glutathione Synthetase (GSS) Antibody
20-abx225203	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Recombinant Glutathione Synthetase (GSS)
4-RPD757Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P48637 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Glutathione Synthetase expressed in: E.coli

Recombinant Glutathione Synthetase (GSS)
4-RPD757Mu01	Cloud-Clone	EUR 492.45 EUR 235.00 EUR 1571.68 EUR 590.56 EUR 1081.12 EUR 392.00 EUR 3779.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51855 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Glutathione Synthetase expressed in: E.coli

Recombinant Glutathione Synthetase (GSS)
4-RPD757Ra01	Cloud-Clone	EUR 501.41 EUR 237.00 EUR 1605.28 EUR 601.76 EUR 1103.52 EUR 398.00 EUR 3863.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P46413 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.8kDa Isoelectric Point: Inquire
Description: Recombinant Rat Glutathione Synthetase expressed in: E.coli

Rat Glutathione synthetase, Gss ELISA KIT
ELI-27966r	Lifescience Market	96 Tests	EUR 886

Mouse Glutathione synthetase, Gss ELISA KIT
ELI-42795m	Lifescience Market	96 Tests	EUR 865

Bovine Glutathione synthetase, GSS ELISA KIT
ELI-48469b	Lifescience Market	96 Tests	EUR 928

Rat Glutathione synthetase (GSS) ELISA Kit
20-abx155614	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Glutathione synthetase (GSS) ELISA Kit
20-abx154119	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Glutathione synthetase(GSS) ELISA kit
CSB-EL009969RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Glutathione synthetase (GSS) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Glutathione synthetase(GSS) ELISA kit
1-CSB-EL009969RA	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Glutathione synthetase(GSS) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Glutathione Synthetase ELISA Kit (GSS)
RK02870	Abclonal	96 Tests	EUR 521

Rat Glutathione Synthetase(GSS)ELISA Kit
QY-E11907	Qayee Biotechnology	96T	EUR 374

Mouse Glutathione Synthetase (GSS) ELISA Kit
SED757Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutathione Synthetase (GSS) in tissue homogenates, cell lysates and other biological fluids.

Mouse Glutathione Synthetase (GSS) ELISA Kit
SED757Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutathione Synthetase (GSS) in tissue homogenates, cell lysates and other biological fluids.

Mouse Glutathione Synthetase (GSS) ELISA Kit
SED757Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutathione Synthetase (GSS) in tissue homogenates, cell lysates and other biological fluids.

Mouse Glutathione Synthetase (GSS) ELISA Kit
SED757Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Glutathione Synthetase (GSS) in tissue homogenates, cell lysates and other biological fluids.

Mouse Glutathione Synthetase (GSS) ELISA Kit
4-SED757Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glutathione Synthetase elisa. Alternative names of the recognized antigen: Glutathione synthase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Glutathione Synthetase (GSS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Glutathione Synthetase (GSS) ELISA Kit
SED757Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glutathione Synthetase (GSS) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Glutathione Synthetase (GSS) ELISA Kit
SED757Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glutathione Synthetase (GSS) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Glutathione Synthetase (GSS) ELISA Kit
SED757Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glutathione Synthetase (GSS) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Glutathione Synthetase (GSS) ELISA Kit
SED757Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Glutathione Synthetase (GSS) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Glutathione Synthetase (GSS) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Glutathione Synthetase (GSS) ELISA Kit
4-SED757Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glutathione Synthetase elisa. Alternative names of the recognized antigen: Glutathione synthase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Glutathione Synthetase (GSS) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Glutathione Synthetase (GSS) Protein
20-abx066859	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Glutathione Synthetase (GSS) Antibody
33029-05111	AssayPro	150 ug	EUR 261

Human Glutathione Synthetase (GSS) AssayMax ELISA Kit
EG2827-1	AssayPro	96 Well Plate	EUR 477

ELISA kit for Human GSS (Glutathione Synthetase)
ELK4091	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glutathione Synthetase (GSS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gluta Show more
Description: A sandwich ELISA kit for detection of Glutathione Synthetase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Glutathione synthetase (GSS) CLIA Kit
20-abx494369	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Rat GSS (Glutathione Synthetase)
ELK6525	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glutathione Synthetase (GSS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gluta Show more
Description: A sandwich ELISA kit for detection of Glutathione Synthetase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse GSS (Glutathione Synthetase)
ELK6730	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glutathione Synthetase (GSS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gluta Show more
Description: A sandwich ELISA kit for detection of Glutathione Synthetase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Glutathione synthetase (GSS) CLIA Kit
20-abx494370	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Glutathione synthetase (GSS) CLIA Kit
20-abx494371	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Glutathione Synthetase (GSS) Protein
20-abx066860	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Glutathione Synthetase (GSS) Protein
20-abx066861	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Glutathione Synthetase (GSS) Antibody (HRP)
20-abx335826	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione Synthetase (GSS) Antibody (FITC)
20-abx335827	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione Synthetase (GSS) Antibody (Biotin)
20-abx335828	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gss ELISA Kit| Rat Glutathione synthetase ELISA Kit
EF018748	Lifescience Market	96 Tests	EUR 689

Gss ELISA Kit| Mouse Glutathione synthetase ELISA Kit
EF015060	Lifescience Market	96 Tests	EUR 689

GSS ELISA Kit| Bovine Glutathione synthetase ELISA Kit
EF011438	Lifescience Market	96 Tests	EUR 689

GSS Glutathione Synthetase Human Recombinant Protein
PROTP48637	BosterBio	Regular: 20ug	EUR 317
Description: GSS Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 494 amino acids (1-474 a.a.) and having a molecular mass of 54.5kDa. The GSS is purified by proprietary chromatographic techniques.

Glutathione Synthetase (GSS) Polyclonal Antibody (Mouse)
4-PAD757Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Glutathione Synthetase (GSS)

Glutathione Synthetase (GSS) Polyclonal Antibody (Rat)
4-PAD757Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione Synthetase (GSS)

Human Glutathione Synthetase (GSS) Antibody (Biotin Conjugate)
33029-05121	AssayPro	150 ug	EUR 369

Glutathione Synthetase (GSS) Polyclonal Antibody (Mouse), APC
4-PAD757Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Glutathione Synthetase (GSS). This antibody is labeled with APC.

Glutathione Synthetase (GSS) Polyclonal Antibody (Mouse), Biotinylated
4-PAD757Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Glutathione Synthetase (GSS). This antibody is labeled with Biotin.

Glutathione Synthetase (GSS) Polyclonal Antibody (Mouse), Cy3
4-PAD757Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Glutathione Synthetase (GSS). This antibody is labeled with Cy3.

Glutathione Synthetase (GSS) Polyclonal Antibody (Mouse), FITC
4-PAD757Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Glutathione Synthetase (GSS). This antibody is labeled with FITC.

Glutathione Synthetase (GSS) Polyclonal Antibody (Mouse), HRP
4-PAD757Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Glutathione Synthetase (GSS). This antibody is labeled with HRP.

Glutathione Synthetase (GSS) Polyclonal Antibody (Mouse), PE
4-PAD757Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Glutathione Synthetase (GSS). This antibody is labeled with PE.

Glutathione Synthetase (GSS) Polyclonal Antibody (Rat), APC
4-PAD757Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione Synthetase (GSS). This antibody is labeled with APC.

Glutathione Synthetase (GSS) Polyclonal Antibody (Rat), Biotinylated
4-PAD757Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione Synthetase (GSS). This antibody is labeled with Biotin.

Glutathione Synthetase (GSS) Polyclonal Antibody (Rat), Cy3
4-PAD757Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione Synthetase (GSS). This antibody is labeled with Cy3.

Glutathione Synthetase (GSS) Polyclonal Antibody (Rat), FITC
4-PAD757Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione Synthetase (GSS). This antibody is labeled with FITC.

Glutathione Synthetase (GSS) Polyclonal Antibody (Rat), HRP
4-PAD757Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione Synthetase (GSS). This antibody is labeled with HRP.

Glutathione Synthetase (GSS) Polyclonal Antibody (Rat), PE
4-PAD757Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione Synthetase (GSS). This antibody is labeled with PE.

Human Glutathione Synthetase (GSS) AssayLite Antibody (FITC Conjugate)
33029-05141	AssayPro	150 ug	EUR 428

Human Glutathione Synthetase (GSS) AssayLite Antibody (RPE Conjugate)
33029-05151	AssayPro	150 ug	EUR 428

Human Glutathione Synthetase (GSS) AssayLite Antibody (APC Conjugate)
33029-05161	AssayPro	150 ug	EUR 428

Human Glutathione Synthetase (GSS) AssayLite Antibody (PerCP Conjugate)
33029-05171	AssayPro	150 ug	EUR 471

Glutathione Synthetase (GSS) Polyclonal Antibody (Human, Mouse, Rat)
4-PAD757Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Asp268~Val474) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione Synthetase (GSS)

Glutathione Synthetase (GSS) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAD757Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Asp268~Val474) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione Synthetase (GSS). This antibody is labeled with APC.

Glutathione Synthetase (GSS) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAD757Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Asp268~Val474) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione Synthetase (GSS). This antibody is labeled with Biotin.

Glutathione Synthetase (GSS) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAD757Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Asp268~Val474) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione Synthetase (GSS). This antibody is labeled with Cy3.

Glutathione Synthetase (GSS) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAD757Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Asp268~Val474) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione Synthetase (GSS). This antibody is labeled with FITC.

Glutathione Synthetase (GSS) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAD757Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Asp268~Val474) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione Synthetase (GSS). This antibody is labeled with HRP.

Glutathione Synthetase (GSS) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAD757Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Asp268~Val474) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione Synthetase (GSS). This antibody is labeled with PE.

Glutathione Synthetase (GSS) Polyclonal Antibody (Mouse), APC-Cy7
4-PAD757Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Glutathione Synthetase (GSS). This antibody is labeled with APC-Cy7.

Glutathione Synthetase (GSS) Polyclonal Antibody (Rat), APC-Cy7
4-PAD757Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Tyr270~Val474) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione Synthetase (GSS). This antibody is labeled with APC-Cy7.

Glutathione Synthetase (GSS) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAD757Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSS (Asp268~Val474) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione Synthetase (GSS). This antibody is labeled with APC-Cy7.

Recombinant Human Glutathione Synthetase
7-02884	CHI Scientific	5µg	Ask for price

Recombinant Human Glutathione Synthetase
7-02885	CHI Scientific	20µg	Ask for price

Recombinant Human Glutathione Synthetase
7-02886	CHI Scientific	1mg	Ask for price

Glutathione synthetase (Recombinant)
20-abx073170	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Glutathione Synthetase Antibody
49843-100ul	SAB	100ul	EUR 333

Glutathione Synthetase Antibody
49843-50ul	SAB	50ul	EUR 239

GSS ELISA KIT|Human
EF005052	Lifescience Market	96 Tests	EUR 689

Glutathione Synthetase Conjugated Antibody
C49843	SAB	100ul	EUR 397

Anti-Glutathione Synthetase (4B6)
YF-MA13343	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Glutathione Synthetase

GSS ELISA Kit (Human) (OKCD00919)
OKCD00919	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

Glutathione Synthetase recombinant monoclonal antibody
A5846	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human Glutathione Synthetase for WB, IHC,ELISA

Anti-glutathione synthetase (5G4-2E9)
YF-MA10390	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to glutathione synthetase

GSS ELISA Kit (Rat) (OKCD01258)
OKCD01258	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.33 ng/mL

GSS ELISA Kit (Mouse) (OKAN06293)
OKAN06293	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

GSS ELISA Kit (Mouse) (OKCD08527)
OKCD08527	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

GSS ELISA Kit (Mouse) (OKDD00775)
OKDD00775	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.058ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Glutathione ELISA kit
E01G0233-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione ELISA kit
E01G0233-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione ELISA kit
E01G0233-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

GSS siRNA
20-abx902347	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSS siRNA
20-abx918801	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSS siRNA
20-abx918802	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSS Antibody
ABD6214	Lifescience Market	100 ug	EUR 438

GSS Antibody
32143-100ul	SAB	100ul	EUR 252

GSS antibody
10R-4260	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal GSS antibody

GSS antibody
10R-4261	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal GSS antibody

GSS Antibody
DF6214	Affbiotech	200ul	EUR 304
Description: GSS Antibody detects endogenous levels of total GSS.

GSS Antibody
CSB-PA009969KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GSS. Recognizes GSS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

GSS Antibody
CSB-PA009969KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GSS. Recognizes GSS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

GSS Antibody
1-CSB-PA009969LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSS. Recognizes GSS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

Human GSS shRNA Plasmid
20-abx951985	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GSS Recombinant Protein (Human)
RP014098	ABM	100 ug	Ask for price

Human Glutamine synthetase ELISA kit
E01G0012-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamine synthetase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamine synthetase ELISA kit
E01G0012-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamine synthetase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutamine synthetase ELISA kit
E01G0012-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutamine synthetase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human thymidylate synthetase ELISA Kit
ELA-E0949h	Lifescience Market	96 Tests	EUR 824

Human Glutathione, GSH ELISA Kit
CELI-66000h	Lifescience Market	96 Tests	EUR 824

Human Glutathione Reductase ELISA kit
E01G0238-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase ELISA kit
E01G0238-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione Reductase ELISA kit
E01G0238-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione Reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Reduced glutathione ELISA kit
E01G0367-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Reduced glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Reduced glutathione ELISA kit
E01G0367-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Reduced glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Reduced glutathione ELISA kit
E01G0367-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Reduced glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione peroxidase ELISA kit
E01G0369-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutathione peroxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione peroxidase ELISA kit
E01G0369-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutathione peroxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione peroxidase ELISA kit
E01G0369-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Glutathione peroxidase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione reductase ELISA kit
E01G0565-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione reductase ELISA kit
E01G0565-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glutathione reductase ELISA kit
E01G0565-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Glutathione reductase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Oxidized Glutathione ELISA kit
E01O0028-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Oxidized Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Oxidized Glutathione ELISA kit
E01O0028-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Oxidized Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Oxidized Glutathione ELISA kit
E01O0028-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Oxidized Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human glutathione(GSH)ELISA Kit
GA-E1479HM-48T	GenAsia Biotech	48T	EUR 289

Human glutathione(GSH)ELISA Kit
GA-E1479HM-96T	GenAsia Biotech	96T	EUR 466

Human glutathione,GSH ELISA Kit
201-12-1463	SunredBio	96 tests	EUR 440
This glutathione ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human glutathione,GSH ELISA Kit
CN-03613H1	ChemNorm	96T	EUR 454

Human glutathione,GSH ELISA Kit
CN-03613H2	ChemNorm	48T	EUR 303

Human glutathione(GSH)ELISA Kit
QY-E03325	Qayee Biotechnology	96T	EUR 361

GSS Conjugated Antibody
C32143	SAB	100ul	EUR 397

GSS cloning plasmid
CSB-CL009969HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1425 Sequence: atggccaccaactgggggagcctcttgcaggataaacagcagctagaggagctggcacggcaggccgtggaccgggccctggctgagggagtattgctgaggacctcacaggagcccacttcctcggaggtggtgagctatgccccattcacgctcttcccctcactggtcccca Show more
Description: A cloning plasmid for the GSS gene.

GSS Rabbit pAb
A1069-100ul	Abclonal	100 ul	EUR 308

GSS Rabbit pAb
A1069-200ul	Abclonal	200 ul	EUR 459

GSS Rabbit pAb
A1069-20ul	Abclonal	20 ul	EUR 183

GSS Rabbit pAb
A1069-50ul	Abclonal	50 ul	EUR 223

GSS Rabbit pAb
A13495-100ul	Abclonal	100 ul	EUR 308

GSS Rabbit pAb
A13495-200ul	Abclonal	200 ul	EUR 459

GSS Rabbit pAb
A13495-20ul	Abclonal	20 ul	EUR 183

GSS Rabbit pAb
A13495-50ul	Abclonal	50 ul	EUR 223

GSS Polyclonal Antibody
A69527	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

GSS Blocking Peptide
DF6214-BP	Affbiotech	1mg	EUR 195

Anti-GSS antibody
STJ23883	St John's Laboratory	100 µl	EUR 277
Description: Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency.

Anti-GSS antibody
STJ115456	St John's Laboratory	100 µl	EUR 277
Description: Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency.

Anti-GSS antibody
STJ116746	St John's Laboratory	100 µl	EUR 413
Description: Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Glutamine Synthetase ELISA kit
55R-1890	Fitzgerald	1 kit	EUR 743
Description: ELISA kit for the detection of Glutamine Synthetase in the research laboratory

Glutathione (GSH) ELISA Kit
abx573700-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Goat Glutathione ELISA kit
E06G0233-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glutathione ELISA kit
E06G0233-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glutathione ELISA kit
E06G0233-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glutathione ELISA kit
E02G0233-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glutathione ELISA kit
E02G0233-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glutathione ELISA kit
E02G0233-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glutathione ELISA kit
E03G0233-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glutathione ELISA kit
E03G0233-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glutathione ELISA kit
E03G0233-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutathione ELISA kit
E04G0233-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutathione ELISA kit
E04G0233-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glutathione ELISA kit
E04G0233-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Fish glutathione ELISA Kit
ELA-E0294f	Lifescience Market	96 Tests	EUR 928

Rat glutathione ELISA Kit
ELA-E0294r	Lifescience Market	96 Tests	EUR 886

Dog Glutathione ELISA kit
E08G0233-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glutathione ELISA kit
E08G0233-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glutathione ELISA kit
E08G0233-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glutathione ELISA kit
E07G0233-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glutathione ELISA kit
E07G0233-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glutathione ELISA kit
E07G0233-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glutathione ELISA kit
E09G0233-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glutathione ELISA kit
E09G0233-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glutathione in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GSS(Glutathione Synthetase) ELISA Kit