
Human brain gene expression atlas project

Human ITLN2(Intelectin 2) ELISA Kit

Human ITLN2(Intelectin 2) ELISA Kit

Human Intelectin 2 (ITLN2) ELISA Kit

RDR-ITLN2-Hu-96Tests 96 Tests
EUR 756

Human Intelectin 2 (ITLN2) ELISA Kit

RD-ITLN2-Hu-48Tests 48 Tests
EUR 521

Human Intelectin 2 (ITLN2) ELISA Kit

RD-ITLN2-Hu-96Tests 96 Tests
EUR 723

Human Intelectin 2 (ITLN2)ELISA Kit

201-12-2755 96 tests
EUR 440
  • This Intelectin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Intelectin 2 (ITLN2) ELISA Kit

abx252683-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ITLN2(Intelectin 2) ELISA Kit

EH3280 96T
EUR 524.1
  • Detection range: 6.25-400 ng/ml
  • Uniprot ID: Q8WWU7
  • Alias: ITLN2/Endothelial lectin HL-2/HL-2/Intelectin-b/Itln1b/ITLN2/Itlnb/HL-2/intelectin 2/UNQ2789/PRO7179
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 3.75 ng/ml

Human Intelectin- 2, ITLN2 ELISA KIT

ELI-28050h 96 Tests
EUR 824

Human Intelectin 2(ITLN2)ELISA Kit

QY-E02126 96T
EUR 361

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 2 elisa. Alternative names of the recognized antigen: HL-2
  • Endothelial lectin HL-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 2 (ITLN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Intelectin 2 (ITLN2) Antibody

abx027537-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody

abx027537-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 2 (ITLN2) Antibody

abx037210-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Intelectin 2 (ITLN2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Intelectin 2 (ITLN2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Human ITLN2 (Intelectin 2)

E-EL-H5562 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN2 (Intelectin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ITLN2 (Intelectin 2)

ELK3892 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 2 (ITLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 2
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 2 (ITLN2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.


EF006945 96 Tests
EUR 689

ITLN2 ELISA Kit (Human) (OKCD01969)

OKCD01969 96 Wells
EUR 831
Description: Description of target: May play a role in the defense system against pathogens.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.06 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

ITLN2 Antibody

42927-100ul 100ul
EUR 252

ITLN2 Antibody

39630-100ul 100ul
EUR 390

ITLN2 antibody

70R-4496 50 ug
EUR 467
Description: Rabbit polyclonal ITLN2 antibody raised against the middle region of ITLN2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Intelectin 1 (ITLN1)ELISA Kit

201-12-2754 96 tests
EUR 440
  • This Intelectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Hu-48T 48T
EUR 479
  • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Hu-96T 96T
EUR 621
  • Should the Human Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 1 (ITLN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Intelectin 1 (ITLN1) ELISA Kit

abx253532-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Intelectin-1

EK2456 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Intelectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ITLN1/ Intelectin-1 ELISA Kit

E1354Hu 1 Kit
EUR 537

Human ITLN1(Intelectin-1 ) ELISA Kit

EH0564 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: Q8WWA0
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor/omentin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Intelectin- 1, ITLN1 ELISA KIT

ELI-03070h 96 Tests
EUR 824

Human Intelectin 1(ITLN1)ELISA Kit

QY-E02127 96T
EUR 361

Human Intelectin 1 ELISA Kit (ITLN1)

RK01714 96 Tests
EUR 521

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 1 (ITLN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Hu-48Tests 48 Tests
EUR 500

Human Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Hu-96Tests 96 Tests
EUR 692

Human Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Hu-48Tests 48 Tests
EUR 478

Human Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Hu-96Tests 96 Tests
EUR 662

Human ITLN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ITLN2 Recombinant Protein (Human)

RP040183 100 ug Ask for price

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1106803 1.0 ug DNA
EUR 154

Human Intelectin 1/Omentin (ITLN1) ELISA Kit

abx055557-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Omentin/intelectin-1 PicoKine ELISA Kit

EK1849 96 wells
EUR 425
Description: For quantitative detection of human Omentin/intelectin-1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

ELISA kit for Human ITLN1 (Intelectin 1)

ELK2003 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 1/Omentin (ITLN1) ELISA Kit

abx574465-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

ITLN2 Blocking Peptide

33R-9353 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN2 antibody, catalog no. 70R-4496

ITLN2 Conjugated Antibody

C42927 100ul
EUR 397

ITLN2 cloning plasmid

CSB-CL837867HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 975
  • Sequence: atgctgtccatgctgaggacaatgaccagactctgcttcctgttattcttctctgtggccaccagtgggtgcagtgcagcagcctcttctcttgagatgctctcgagggaattcgaaacctgtgccttctccttttcttccctgcctagaagctgcaaagaaatcaaggaacgctg
  • Show more
Description: A cloning plasmid for the ITLN2 gene.

Mouse Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Mu-48T 48T
EUR 489
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Mu-96T 96T
EUR 635
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Ra-48T 48T
EUR 508
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Ra-96T 96T
EUR 661
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Intelectin 1 (ITLN1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Intelectin- 1a, Itln1 ELISA KIT

ELI-03069m 96 Tests
EUR 865

Mouse Intelectin 1a (ITLN1) ELISA Kit

abx575109-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Intelectin- 1b, Itln1b ELISA KIT

ELI-39394m 96 Tests
EUR 865

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Mu-48Tests 48 Tests
EUR 511

Mouse Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Mu-96Tests 96 Tests
EUR 709

Rat Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Ra-48Tests 48 Tests
EUR 534

Rat Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Ra-96Tests 96 Tests
EUR 742

Mouse Intelectin 1 ELISA Kit (ITLN1)

RK02963 96 Tests
EUR 521

Mouse Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Mu-48Tests 48 Tests
EUR 489

Mouse Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Mu-96Tests 96 Tests
EUR 677

Rat Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Ra-48Tests 48 Tests
EUR 511

Rat Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Ra-96Tests 96 Tests
EUR 709

ITLN2 ORF Vector (Human) (pORF)

ORF013395 1.0 ug DNA
EUR 354


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

ELISA kit for Human ITLN1 (Intelectin 1/Omentin)

E-EL-H2028 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Human Intelectin 1 (ITLN1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Polyclonal ITLN2 Antibody (Center)

APR11252G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ITLN2 (Center). This antibody is tested and proven to work in the following applications:

Mouse Intelectin 1/Omentin (ITLN1) ELISA Kit

abx254237-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit

abx255780-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

ELISA kit for Mouse ITLN1 (Intelectin 1)

ELK2004 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat ITLN1 (Intelectin 1)

ELK2005 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Monkey Intelectin 1/Omentin (ITLN1) ELISA Kit

abx359483-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Intelectin 1/Omentin (ITLN1) ELISA Kit

abx361255-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Intelectin 1/Omentin (ITLN1) ELISA Kit

abx362579-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Intelectin 1/Omentin (ITLN1) ELISA Kit

abx356771-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit

abx576145-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse ITLN1(Intelectin 1/Omentin) ELISA Kit

EM1180 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O88310
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Rat ITLN1(Intelectin 1/Omentin) ELISA Kit

ER1117 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

ELISA kit for Mouse Intelectin 1 (ITLN1)

KTE71460-48T 48T
EUR 332
  • Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)

KTE71460-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)

KTE71460-96T 96T
EUR 539
  • Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ITLN1 ELISA Kit| Rat Intelectin 1/Omentin ELISA Kit

EF017857 96 Tests
EUR 689

ITLN1 ELISA Kit| Mouse Intelectin 1/Omentin ELISA Kit

EF013735 96 Tests
EUR 689

ITLN2 sgRNA CRISPR Lentivector set (Human)

K1106801 3 x 1.0 ug
EUR 339

Human Intelectin 1/Omentin (ITLN1) CLIA Kit

abx195758-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Intelectin 1 (ITLN1) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ELISA kit for Mouse ITLN1 (Intelectin 1/Omentin)

E-EL-M0857 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat ITLN1 (Intelectin 1/Omentin)

E-EL-R0689 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Guinea pig Intelectin 1/Omentin (ITLN1) ELISA Kit

abx357571-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1106802 1.0 ug DNA
EUR 154

ITLN2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1106804 1.0 ug DNA
EUR 154

ITLN2 Protein Vector (Human) (pPB-C-His)

PV053577 500 ng
EUR 481

ITLN2 Protein Vector (Human) (pPB-N-His)

PV053578 500 ng
EUR 481

ITLN2 Protein Vector (Human) (pPM-C-HA)

PV053579 500 ng
EUR 481

ITLN2 Protein Vector (Human) (pPM-C-His)

PV053580 500 ng
EUR 481

Mouse Intelectin 1 (ITLN1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Intelectin 1 (ITLN1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

CLIA kit for Human ITLN1 (Intelectin 1/Omentin)

E-CL-H1228 1 plate of 96 wells
EUR 584
  • Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Intelectin 1 (ITLN1) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 1 (ITLN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 1 (ITLN1) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Intelectin 1 (ITLN1)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WWA0
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.4kDa
  • Isoelectric Point: 7.2
Description: Recombinant Human Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)

  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O88310
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.7kDa
  • Isoelectric Point: 8.8
Description: Recombinant Mouse Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q499T8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Intelectin 1 expressed in: E.coli

ITLN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1106807 1.0 ug DNA
EUR 167

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Mouse Intelectin 1/Omentin (ITLN1) CLIA Kit

abx195759-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) CLIA Kit

abx195760-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Human Fibrinogen (FBG) AssayMax ELISA Kit

EF1040-2 96 Well Plate
EUR 396

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Dr. P Kit-Solution 2

K2021010-2 6 ml
EUR 120
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

Intelectin 1/Omentin (ITLN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody

abx036572-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Mouse Intelectin 1 (ITLN1) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Intelectin 1 (ITLN1) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Intelectin 1/Omentin (ITLN1) Antibody

abx234415-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Intelectin 1/Omentin (ITLN1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1)

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

IL-2 Interleukin-2 Human Recombinant Protein, His Tag

PROTP60568-2 Regular: 10ug
EUR 317
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_

Recombinant Human TFF-2 Protein

PROTQ03403-2 20ug
EUR 317
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds.

Recombinant Human BD-2 Protein

PROTO15263-2 20ug
EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues.

Recombinant Human Relaxin-2 Protein

PROTP04090-2 25ug
EUR 317
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain.

Recombinant Human PAI-2 Protein

PROTP05120-2 10ug
EUR 317
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein.

Recombinant Human MMP-2 Protein

PROTP08253-2 10ug
EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids).

ITLN2 3'UTR GFP Stable Cell Line

TU061353 1.0 ml
EUR 1394

ITLN2 3'UTR Luciferase Stable Cell Line

TU011353 1.0 ml
EUR 1394

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

EA5101-2 96 Well Plate
EUR 417

Human Factor X (Factor 10) AssayMax ELISA Kit

EF1010-2 96 Well Plate
EUR 477

CLIA kit for Mouse ITLN1 (Intelectin 1/Omentin)

E-CL-M0525 1 plate of 96 wells
EUR 584
  • Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Rat ITLN1 (Intelectin 1/Omentin)

E-CL-R0491 1 plate of 96 wells
EUR 584
  • Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer

PROTP12643-2 Regular: 20ug
EUR 317
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques.

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

ErbB2 ErbB-2 Human Recombinant Protein

PROTP04626-2 Regular: 20ug
EUR 317
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli.

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Human Apolipoprotein C-I (Apo C1) AssayMax ELISA Kit

EA8011-2 96 Well Plate
EUR 417

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit

DLR-LAB7-2-Hu-48T 48T
EUR 425
  • Should the Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit

DLR-LAB7-2-Hu-96T 96T
EUR 548
  • Should the Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit

RDR-LAB7-2-Hu-48Tests 48 Tests
EUR 436

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit

RDR-LAB7-2-Hu-96Tests 96 Tests
EUR 601

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit

RD-LAB7-2-Hu-48Tests 48 Tests
EUR 418

Human B-Lymphocyte Activation Antigen B7-2 (LAB7-2) ELISA Kit

RD-LAB7-2-Hu-96Tests 96 Tests
EUR 575

Aflatoxin Total ELISA Kit

DEIA051-2 96T
EUR 741
Description: This kit can be used for qualitative and quantitative analysis of aflatoxin total in edible oil, peanut, cereal etc.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with PE.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1)

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1)

LH (Luteinizing Hormone) ELISA test

2 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of LH (Luteinizing Hormone)

Human Pancreas PrimaCell 2: Pancreatic Epithelial Cells

2-96123 1 Kit Ask for price

ENO2 Neurone Specific Enolase 2 Human protein

PROTP09104-2 Regular: 20ug
EUR 317
Description: Human Neurone Specific Enolase produced in Human CNS having a molecular mass of 45kDa.

ITLN2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1106805 3 x 1.0 ug
EUR 376

PLGF2 Human, Placenta Growth Factor-2 Human Recombinant Protein, CHO

PROTP49763-2 Regular: 25ug
EUR 317
Description: PLGF2 Human Recombinant (19-170 a.a.) produced in CHO is a disulfide-linked homodimeric, glycosylated, polypeptide chain containing 152 amino acids and having a molecular mass of 33kDa.;The PLGF-2 Human Recombinant protein is purified by proprietary chromatographic techniques.

B2M Human, Beta 2 Microglobulin Human Recombinant Protein, His Tag

PROTP61769-2 Regular: 5ug
EUR 317
Description: B2M Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 120 amino acids (1-119 a.a.) and having a molecular mass of 14 kDa. The B2M is fused to a 21 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Bovine Haptoglobin AssayMax ELISA Kit

EBH2003-2 96 Well Plate
EUR 417

Human ITLN2(Intelectin 2) ELISA Kit