Human KRT6A(Keratin 6A) ELISA Kit

Human KRT6A(Keratin 6A) ELISA Kit

Human Keratin 6A (KRT6A) ELISA Kit
RD-KRT6A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Keratin 6A (KRT6A) ELISA Kit
RD-KRT6A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Keratin 6A (KRT6A) ELISA Kit
RDR-KRT6A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Keratin 6A (KRT6A) ELISA Kit
RDR-KRT6A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Keratin 6A (KRT6A) ELISA Kit
abx574972-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Keratin 6A (KRT6A) ELISA Kit
20-abx152117	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Keratin 6A (KRT6A) ELISA Kit
abx250371-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Keratin 6A(KRT6A)ELISA Kit
QY-E02821	Qayee Biotechnology	96T	EUR 361

Human Keratin 6A (KRT6A) ELISA Kit
SED234Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 6A (KRT6A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 6A (KRT6A) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 6A (KRT6A) ELISA Kit
SED234Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 6A (KRT6A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 6A (KRT6A) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 6A (KRT6A) ELISA Kit
SED234Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 6A (KRT6A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 6A (KRT6A) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 6A (KRT6A) ELISA Kit
SED234Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 6A (KRT6A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 6A (KRT6A) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 6A (KRT6A) ELISA Kit
4-SED234Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Keratin 6A elisa. Alternative names of the recognized antigen: K6A KRT6C KRT6D CK6C K6C CK6D K6D Keratin 6C Keratin 6D Keratin, type II cytoskeletal 6A Type-II keratin Kb6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 6A (KRT6A) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Keratin 6A (KRT6A) Antibody
20-abx113347	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
20-abx109957	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
20-abx002875	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
20-abx159587	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
abx146382-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
20-abx100825	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 6A (KRT6A) Antibody
20-abx100826	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Keratin 6A (KRT6A) Antibody
20-abx100827	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 6A (KRT6A) Antibody
20-abx005878	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
abx029191-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
abx029191-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
20-abx322514	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
20-abx322515	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
20-abx214450	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
20-abx214451	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody
20-abx304308	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Keratin 6A (KRT6A)
4-RPD234Hu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P02538 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 41.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Keratin 6A expressed in: E.coli

Recombinant Keratin 6A (KRT6A)
4-RPD234Ra01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q4FZU2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.5kDa Isoelectric Point: Inquire
Description: Recombinant Rat Keratin 6A expressed in: E.coli

Mouse Keratin 6A (KRT6A) ELISA Kit
abx514580-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Keratin 6A (KRT6A) ELISA Kit
abx514581-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Keratin 6A (KRT6A) Protein
20-abx067627	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Keratin 6A (KRT6A) CLIA Kit
20-abx494164	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human KRT6A (Keratin 6A)
ELK4079	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 6A (KRT6A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 6A (KRT Show more
Description: A sandwich ELISA kit for detection of Keratin 6A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Keratin 6A (KRT6A) Protein
20-abx067628	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Keratin 6A (KRT6A) Antibody (HRP)
20-abx108449	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (Biotin)
20-abx105610	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (FITC)
20-abx107028	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (FITC)
20-abx273604	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Keratin 6A (KRT6A) Antibody (Biotin)
20-abx272329	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Keratin 6A (KRT6A) Antibody (Biotin)
20-abx273406	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Keratin 6A (KRT6A) Antibody (HRP)
20-abx304309	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (FITC)
20-abx304310	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (Biotin)
20-abx304311	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Keratin 6A (KRT6A) Monoclonal Antibody (Human)
4-MAD234Hu21	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Glu163~Leu468 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A)

Human KRT6A/ Keratin, type II cytoskeletal 6A ELISA Kit
E1407Hu	Sunlong	1 Kit	EUR 605

Human KRT6A(Keratin, type II cytoskeletal 6A) ELISA Kit
EH1123	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: P02538 Alias: KRT6A(Keratin, type II cytoskeletal 6A)/K6A/CK-6A/CK-6D/Type-II keratin Kb6/Keratin-6A/Cytokeratin-6A/Cytokeratin-6D/KRT6D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Keratin, type II cytoskeletal 6A, KRT6A ELISA KIT
ELI-08063h	Lifescience Market	96 Tests	EUR 824

Human Keratin, type II cytoskeletal 6A(KRT6A) ELISA kit
CSB-EL012561HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Keratin, type II cytoskeletal 6A (KRT6A) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Keratin, type II cytoskeletal 6A(KRT6A) ELISA kit
1-CSB-EL012561HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Keratin, type II cytoskeletal 6A(KRT6A) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Keratin, type II cytoskeletal 6A (KRT6A)
1-CSB-EP012561HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 63.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Keratin, type II cytoskeletal 6A(KRT6A) expressed in E.coli

Human Keratin, type II cytoskeletal 6A (KRT6A)
1-CSB-EP012561HUe0	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 86.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Keratin, type II cytoskeletal 6A(KRT6A) expressed in E.coli

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat)
4-PAD234Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Ile323~Glu461) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A)

Keratin 6A (KRT6A) Monoclonal Antibody (Human), APC
4-MAD234Hu21-APC	Cloud-Clone	EUR 358.00 EUR 3455.00 EUR 957.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Glu163~Leu468 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with APC.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), Biotinylated
4-MAD234Hu21-Biotin	Cloud-Clone	EUR 320.00 EUR 2592.00 EUR 760.00 EUR 394.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Glu163~Leu468 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with Biotin.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), Cy3
4-MAD234Hu21-Cy3	Cloud-Clone	EUR 435.00 EUR 4565.00 EUR 1235.00 EUR 569.00 EUR 258.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Glu163~Leu468 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with Cy3.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), FITC
4-MAD234Hu21-FITC	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Glu163~Leu468 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with FITC.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), HRP
4-MAD234Hu21-HRP	Cloud-Clone	EUR 327.00 EUR 3011.00 EUR 846.00 EUR 413.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Glu163~Leu468 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with HRP.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), PE
4-MAD234Hu21-PE	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Glu163~Leu468 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with PE.

Rat Krt6a/ Keratin, type II cytoskeletal 6A ELISA Kit
E0550Ra	Sunlong	1 Kit	EUR 646

Mouse Krt6a/ Keratin, type II cytoskeletal 6A ELISA Kit
E0841Mo	Sunlong	1 Kit	EUR 632

Mouse Keratin, type II cytoskeletal 6A, Krt6a ELISA KIT
ELI-47826m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human Keratin, type II cytoskeletal 6A (KRT6A)
KTE61875-48T	Abbkine	48T	EUR 332
Keratin 6A is a type II cytokeratin, one of a number of isoforms of keratin 6 encoded by separate genes located within the type II keratin gene cluster on human chromosome 12q. It is found with keratin 16 and/or keratin 17 in the palm and sole epider Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type II cytoskeletal 6A (KRT6A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type II cytoskeletal 6A (KRT6A)
KTE61875-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Keratin 6A is a type II cytokeratin, one of a number of isoforms of keratin 6 encoded by separate genes located within the type II keratin gene cluster on human chromosome 12q. It is found with keratin 16 and/or keratin 17 in the palm and sole epider Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type II cytoskeletal 6A (KRT6A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type II cytoskeletal 6A (KRT6A)
KTE61875-96T	Abbkine	96T	EUR 539
Keratin 6A is a type II cytokeratin, one of a number of isoforms of keratin 6 encoded by separate genes located within the type II keratin gene cluster on human chromosome 12q. It is found with keratin 16 and/or keratin 17 in the palm and sole epider Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type II cytoskeletal 6A (KRT6A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat)
4-PAD234Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Glu163~Leu468) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A)

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), APC
4-PAD234Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Ile323~Glu461) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with APC.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAD234Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Ile323~Glu461) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with Biotin.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), Cy3
4-PAD234Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Ile323~Glu461) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with Cy3.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), FITC
4-PAD234Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Ile323~Glu461) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with FITC.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), HRP
4-PAD234Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Ile323~Glu461) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with HRP.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), PE
4-PAD234Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Ile323~Glu461) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with PE.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), APC-Cy7
4-MAD234Hu21-APC-Cy7	Cloud-Clone	EUR 596.00 EUR 6790.00 EUR 1795.00 EUR 796.00 EUR 329.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Glu163~Leu468 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with APC-Cy7.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAD234Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Glu163~Leu468) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with APC.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAD234Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Glu163~Leu468) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with Biotin.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAD234Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Glu163~Leu468) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with Cy3.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAD234Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Glu163~Leu468) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with FITC.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAD234Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Glu163~Leu468) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with HRP.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAD234Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Glu163~Leu468) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with PE.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAD234Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Ile323~Glu461) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with APC-Cy7.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAD234Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT6A (Glu163~Leu468) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with APC-Cy7.

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC552368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF555 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC552368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF555 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC612368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF660R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC612368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF660R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC402368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF640R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC402368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF640R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC472368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF647 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC472368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF647 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC052368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF405M conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC052368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF405M conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC042368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF405S conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC042368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF405S conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC432368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF543 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC432368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF543 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNUB2368-100	Biotium	100uL	EUR 264
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Concentration: 0.2mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNUB2368-50	Biotium	50uL	EUR 405
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), 1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNUB2368-500	Biotium	500uL	EUR 513
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Concentration: 0.2mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC682368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF568 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC682368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF568 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC882368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF488A conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC882368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF488A conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC942368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF594 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC942368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF594 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNCB2368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Biotin conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNCB2368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Biotin conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC702368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF770 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC702368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF770 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC802368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF680 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC802368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF680 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNCH2368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNCH2368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNCP2368-250	Biotium	250uL	EUR 394
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), PerCP conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNCA2368-250	Biotium	250uL	EUR 394
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), APC conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNCAP2368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNCAP2368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC812368-100	Biotium	100uL	EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF680R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNC812368-500	Biotium	500uL	EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF680R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody
BNCR2368-250	Biotium	250uL	EUR 394
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), RPE conjugate, Concentration: 0.1mg/mL

ELISA kit for Human Keratin, type II cytoskeletal 6A
EK2528	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Keratin, type II cytoskeletal 6A in samples from serum, plasma, tissue homogenates and other biological fluids.

Krt6a/ Rat Krt6a ELISA Kit
ELI-19728r	Lifescience Market	96 Tests	EUR 886

Human KRT6A ELISA Kit
ELA-E10099h	Lifescience Market	96 Tests	EUR 824

KRT6A ELISA KIT|Human
EF001115	Lifescience Market	96 Tests	EUR 689

KRT6A ELISA Kit (Human) (OKCD08433)
OKCD08433	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified; the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. This KRT6 gene in particular encodes the most abundant isoform. Mutations in these genes have been associated with pachyonychia congenita. In addition, peptides from the C-terminal region of the protein have antimicrobial activity against bacterial pathogens. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL

KRT6A ELISA Kit (Human) (OKEH02048)
OKEH02048	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified, the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. This KRT6 gene in particular encodes the most abundant isoform. Mutations in these genes have been associated with pachyonychia congenita. In addition, peptides from the C-terminal region of the protein have antimicrobial activity against bacterial pathogens. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15 pg/mL

KRT6A ELISA Kit (Mouse) (OKEH05753)
OKEH05753	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Epidermis-specific type I keratin involved in wound healing.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.4 pg/mL

Human Semaphorin- 6A, SEMA6A ELISA KIT
ELI-52440h	Lifescience Market	96 Tests	EUR 824

Human Semaphorin 6A(SEMA6A)ELISA Kit
GA-E1104HM-48T	GenAsia Biotech	48T	EUR 289

Human Semaphorin 6A(SEMA6A)ELISA Kit
GA-E1104HM-96T	GenAsia Biotech	96T	EUR 466

Human Semaphorin 6A (SEMA6A)ELISA Kit
201-12-1088	SunredBio	96 tests	EUR 440
This Semaphorin 6A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Semaphorin 6A(SEMA6A)ELISA Kit
QY-E00788	Qayee Biotechnology	96T	EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-100ug
QP6282-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-10ug
QP6282-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-1mg
QP6282-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-200ug
QP6282-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-500ug
QP6282-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-50ug
QP6282-ec-50ug	EnQuireBio	50ug	EUR 263

Human OTU Deubiquitinase 6A (OTUD6A) ELISA Kit
abx382000-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

KRT6A siRNA
20-abx902906	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT6A siRNA
20-abx922008	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT6A siRNA
20-abx922009	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT6A Antibody
ABD7789	Lifescience Market	100 ug	EUR 438

KRT6A Antibody
35628-100ul	SAB	100ul	EUR 252

KRT6A antibody
70R-18191	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal KRT6A antibody

KRT6A Antibody
DF7789	Affbiotech	200ul	EUR 304
Description: KRT6A Antibody detects endogenous levels of total KRT6A.

KRT6A Antibody
1-CSB-PA012561EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

KRT6A Antibody
1-CSB-PA012561ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

KRT6A Antibody
1-CSB-PA012561ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

KRT6A Antibody
1-CSB-PA012561GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

KRT6A Antibody
1-CSB-PA012561LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

KRT6A Antibody
1-CSB-PA224586	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

KRT6A Antibody
1-CSB-PA160649	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

pOTB7-KRT6A
PVT17959	Lifescience Market	2 ug	EUR 231

pOTB7-KRT6A
PVT17963	Lifescience Market	2 ug	EUR 231

pOTB7-KRT6A
PVT17964	Lifescience Market	2 ug	EUR 231

Human Keratin 9 ELISA Kit
ELA-E2283h	Lifescience Market	96 Tests	EUR 824

Human Keratin 8 ELISA Kit
ELA-E2287h	Lifescience Market	96 Tests	EUR 824

Human Keratin 16 ELISA Kit
ELA-E8852h	Lifescience Market	96 Tests	EUR 824

Human Keratin 15 ELISA Kit
ELA-E8853h	Lifescience Market	96 Tests	EUR 824

Human Keratin 12 ELISA Kit
ELA-E8860h	Lifescience Market	96 Tests	EUR 824

Human Keratin 19 ELISA Kit
ELA-E9126h	Lifescience Market	96 Tests	EUR 824

Human Keratin 20 ELISA Kit
ELA-E9127h	Lifescience Market	96 Tests	EUR 824

Human Keratin 13 ELISA Kit
ELA-E9417h	Lifescience Market	96 Tests	EUR 824

Human KRT6A shRNA Plasmid
20-abx952613	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KRT6A Recombinant Protein (Human)
RP017380	ABM	100 ug	Ask for price

KRT6A Recombinant Protein (Human)
RP017383	ABM	100 ug	Ask for price

CD6
6A-100T	ImmunoStep	100 test	EUR 349

Mouse Semaphorin- 6A, Sema6a ELISA KIT
ELI-52928m	Lifescience Market	96 Tests	EUR 865

Human Actin like protein 6A(ACTL6A) ELISA kit
E01A1222-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Actin like protein 6A(ACTL6A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin like protein 6A(ACTL6A) ELISA kit
E01A1222-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Actin like protein 6A(ACTL6A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin like protein 6A(ACTL6A) ELISA kit
E01A1222-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Actin like protein 6A(ACTL6A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lysine- specific demethylase 6A, KDM6A ELISA KIT
ELI-15846h	Lifescience Market	96 Tests	EUR 824

Human Actin- like protein 6A, ACTL6A ELISA KIT
ELI-35001h	Lifescience Market	96 Tests	EUR 824

Human Actin-Like Protein 6A (ACTL6A) ELISA Kit
20-abx156869	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Phosphodiesterase 6A, CGMP-Specific (PDE6A) ELISA Kit
abx382127-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit
SEK268Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Actin Like Protein 6A (ACTL6A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Actin Like Protein 6A (ACTL6A) in Tissue homogenates, cell lysates and other biological fluids.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit
SEK268Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Actin Like Protein 6A (ACTL6A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Actin Like Protein 6A (ACTL6A) in Tissue homogenates, cell lysates and other biological fluids.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit
SEK268Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Actin Like Protein 6A (ACTL6A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Actin Like Protein 6A (ACTL6A) in Tissue homogenates, cell lysates and other biological fluids.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit
SEK268Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Actin Like Protein 6A (ACTL6A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Actin Like Protein 6A (ACTL6A) in Tissue homogenates, cell lysates and other biological fluids.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit
4-SEK268Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Actin Like Protein 6A elisa. Alternative names of the recognized antigen: Actl6 BAF53A Arp4 Baf53a INO80K BAF Complex 53 kDa Subunit 53 kDa BRG1-associated factor A Actin-Related Protein 4 INO80 Complex Subunit K
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Actin Like Protein 6A (ACTL6A) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Peptide 6A
H-6905.0005	Bachem	5.0mg	EUR 297
Description: Sum Formula: C23H43N9O6; CAS# [73549-32-3]

Peptide 6A
H-6905.0025	Bachem	25.0mg	EUR 1093
Description: Sum Formula: C23H43N9O6; CAS# [73549-32-3]

Semaphorin 6a
GT15056	Neuromics	100 ug	EUR 526

Semaphorin 6a
MO15023	Neuromics	500 ug	EUR 474

6a-Hydroxymaackiain
TB02758	ChemNorm	5mg	EUR 847

6a-Senecioyloxychaparrin
TBZ0849	ChemNorm	unit	Ask for price

6a-Hydroxyeurycomalactone
TBZ1429	ChemNorm	unit	Ask for price

KRT6A Conjugated Antibody
C35628	SAB	100ul	EUR 397

KRT6A cloning plasmid
CSB-CL012561HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1695 Sequence: atggccagcacatccaccaccatcaggagccacagcagcagccgccggggtttcagtgccagctcagccaggctccctggggtcagccgctctggcttcagcagcgtctccgtgtcccgctccaggggcagtggtggcctgggtggtgcatgtggaggagctggctttggcagcc Show more
Description: A cloning plasmid for the KRT6A gene.

KRT6A cloning plasmid
CSB-CL012561HU2-10ug	Cusabio	10ug	EUR 584
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1695 Sequence: atggccagcacatccaccaccatcaggagccacagcagcagccgccggggtttcagtgccaactcagccaggctccctggggtcagccgctctggcttcagcagcgtctccgtgtcccgctccaggggcagtggtggcctgggtggtgcatgtggaggagctggctttggcagcc Show more
Description: A cloning plasmid for the KRT6A gene.

Mouse Krt6a Antibody
abx031155-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mouse Krt6a Antibody
abx031155-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Human KRT6A(Keratin 6A) ELISA Kit