Human KRT6A(Keratin 6A) ELISA Kit

Human KRT6A(Keratin 6A) ELISA Kit

Human Keratin 6A (KRT6A) ELISA Kit

RD-KRT6A-Hu-48Tests 48 Tests
EUR 521

Human Keratin 6A (KRT6A) ELISA Kit

RD-KRT6A-Hu-96Tests 96 Tests
EUR 723

Human Keratin 6A (KRT6A) ELISA Kit

RDR-KRT6A-Hu-48Tests 48 Tests
EUR 544

Human Keratin 6A (KRT6A) ELISA Kit

RDR-KRT6A-Hu-96Tests 96 Tests
EUR 756

Human Keratin 6A (KRT6A) ELISA Kit

abx574972-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Keratin 6A (KRT6A) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Keratin 6A (KRT6A) ELISA Kit

abx250371-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Keratin 6A(KRT6A)ELISA Kit

QY-E02821 96T
EUR 361

Human Keratin 6A (KRT6A) ELISA Kit

SED234Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 6A (KRT6A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 6A (KRT6A) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 6A (KRT6A) ELISA Kit

SED234Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 6A (KRT6A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 6A (KRT6A) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 6A (KRT6A) ELISA Kit

SED234Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 6A (KRT6A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 6A (KRT6A) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 6A (KRT6A) ELISA Kit

SED234Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 6A (KRT6A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 6A (KRT6A) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 6A (KRT6A) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratin 6A elisa. Alternative names of the recognized antigen: K6A
  • KRT6C
  • KRT6D
  • CK6C
  • K6C
  • CK6D
  • K6D
  • Keratin 6C
  • Keratin 6D
  • Keratin, type II cytoskeletal 6A
  • Type-II keratin Kb6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 6A (KRT6A) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Keratin 6A (KRT6A) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

abx146382-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

abx029191-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

abx029191-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Keratin 6A (KRT6A)

  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02538
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Keratin 6A expressed in: E.coli

Recombinant Keratin 6A (KRT6A)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q4FZU2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Keratin 6A expressed in: E.coli

Mouse Keratin 6A (KRT6A) ELISA Kit

abx514580-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Keratin 6A (KRT6A) ELISA Kit

abx514581-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human Keratin 6A (KRT6A) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Keratin 6A (KRT6A) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human KRT6A (Keratin 6A)

ELK4079 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 6A (KRT6A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 6A (KRT
  • Show more
Description: A sandwich ELISA kit for detection of Keratin 6A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Keratin 6A (KRT6A) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Keratin 6A (KRT6A) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Keratin 6A (KRT6A) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Keratin 6A (KRT6A) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Keratin 6A (KRT6A) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin 6A (KRT6A) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Glu163~Leu468
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A)

Human KRT6A/ Keratin, type II cytoskeletal 6A ELISA Kit

E1407Hu 1 Kit
EUR 605

Human KRT6A(Keratin, type II cytoskeletal 6A) ELISA Kit

EH1123 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: P02538
  • Alias: KRT6A(Keratin, type II cytoskeletal 6A)/K6A/CK-6A/CK-6D/Type-II keratin Kb6/Keratin-6A/Cytokeratin-6A/Cytokeratin-6D/KRT6D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Keratin, type II cytoskeletal 6A, KRT6A ELISA KIT

ELI-08063h 96 Tests
EUR 824

Human Keratin, type II cytoskeletal 6A(KRT6A) ELISA kit

CSB-EL012561HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Keratin, type II cytoskeletal 6A (KRT6A) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Keratin, type II cytoskeletal 6A(KRT6A) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Keratin, type II cytoskeletal 6A(KRT6A) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Keratin, type II cytoskeletal 6A (KRT6A)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 63.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Keratin, type II cytoskeletal 6A(KRT6A) expressed in E.coli

Human Keratin, type II cytoskeletal 6A (KRT6A)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 86.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Keratin, type II cytoskeletal 6A(KRT6A) expressed in E.coli

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Ile323~Glu461)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A)

Keratin 6A (KRT6A) Monoclonal Antibody (Human), APC

  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Glu163~Leu468
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with APC.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), Biotinylated

  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Glu163~Leu468
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with Biotin.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), Cy3

  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Glu163~Leu468
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with Cy3.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), FITC

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Glu163~Leu468
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with FITC.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), HRP

  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Glu163~Leu468
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with HRP.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), PE

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Glu163~Leu468
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with PE.

Rat Krt6a/ Keratin, type II cytoskeletal 6A ELISA Kit

E0550Ra 1 Kit
EUR 646

Mouse Krt6a/ Keratin, type II cytoskeletal 6A ELISA Kit

E0841Mo 1 Kit
EUR 632

Mouse Keratin, type II cytoskeletal 6A, Krt6a ELISA KIT

ELI-47826m 96 Tests
EUR 865

ELISA kit for Human Keratin, type II cytoskeletal 6A (KRT6A)

KTE61875-48T 48T
EUR 332
  • Keratin 6A is a type II cytokeratin, one of a number of isoforms of keratin 6 encoded by separate genes located within the type II keratin gene cluster on human chromosome 12q. It is found with keratin 16 and/or keratin 17 in the palm and sole epider
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type II cytoskeletal 6A (KRT6A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type II cytoskeletal 6A (KRT6A)

KTE61875-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Keratin 6A is a type II cytokeratin, one of a number of isoforms of keratin 6 encoded by separate genes located within the type II keratin gene cluster on human chromosome 12q. It is found with keratin 16 and/or keratin 17 in the palm and sole epider
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type II cytoskeletal 6A (KRT6A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratin, type II cytoskeletal 6A (KRT6A)

KTE61875-96T 96T
EUR 539
  • Keratin 6A is a type II cytokeratin, one of a number of isoforms of keratin 6 encoded by separate genes located within the type II keratin gene cluster on human chromosome 12q. It is found with keratin 16 and/or keratin 17 in the palm and sole epider
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Keratin, type II cytoskeletal 6A (KRT6A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Glu163~Leu468)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A)

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Ile323~Glu461)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with APC.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Ile323~Glu461)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with Biotin.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Ile323~Glu461)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with Cy3.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Ile323~Glu461)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with FITC.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Ile323~Glu461)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with HRP.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Ile323~Glu461)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with PE.

Keratin 6A (KRT6A) Monoclonal Antibody (Human), APC-Cy7

  • EUR 596.00
  • EUR 6790.00
  • EUR 1795.00
  • EUR 796.00
  • EUR 329.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Glu163~Leu468
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Keratin 6A (KRT6A). This antibody is labeled with APC-Cy7.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Glu163~Leu468)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with APC.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Glu163~Leu468)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with Biotin.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Glu163~Leu468)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with Cy3.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Glu163~Leu468)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with FITC.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Glu163~Leu468)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with HRP.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Glu163~Leu468)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with PE.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Ile323~Glu461)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 6A (KRT6A). This antibody is labeled with APC-Cy7.

Keratin 6A (KRT6A) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT6A (Glu163~Leu468)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Keratin 6A (KRT6A). This antibody is labeled with APC-Cy7.

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC552368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF555 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC552368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF555 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC612368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF660R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC612368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF660R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC402368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF640R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC402368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF640R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC472368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF647 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC472368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF647 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC052368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF405M conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC052368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF405M conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC042368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF405S conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC042368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF405S conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC432368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF543 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC432368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF543 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNUB2368-100 100uL
EUR 264
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Concentration: 0.2mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNUB2368-50 50uL
EUR 405
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), 1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNUB2368-500 500uL
EUR 513
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Concentration: 0.2mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC682368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF568 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC682368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF568 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC882368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF488A conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC882368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF488A conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC942368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF594 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC942368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF594 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNCB2368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Biotin conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNCB2368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Biotin conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC702368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF770 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC702368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF770 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC802368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF680 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC802368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF680 conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNCH2368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNCH2368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNCP2368-250 250uL
EUR 394
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), PerCP conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNCA2368-250 250uL
EUR 394
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), APC conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNCAP2368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNCAP2368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC812368-100 100uL
EUR 233
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF680R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNC812368-500 500uL
EUR 545
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), CF680R conjugate, Concentration: 0.1mg/mL

Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368) Antibody

BNCR2368-250 250uL
EUR 394
Description: Primary antibody against Cytokeratin 6A (KRT6A) (Basal Cell Marker) (KRT6A/2368), RPE conjugate, Concentration: 0.1mg/mL

ELISA kit for Human Keratin, type II cytoskeletal 6A

EK2528 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Keratin, type II cytoskeletal 6A in samples from serum, plasma, tissue homogenates and other biological fluids.

Krt6a/ Rat Krt6a ELISA Kit

ELI-19728r 96 Tests
EUR 886


ELA-E10099h 96 Tests
EUR 824


EF001115 96 Tests
EUR 689

KRT6A ELISA Kit (Human) (OKCD08433)

OKCD08433 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified; the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. This KRT6 gene in particular encodes the most abundant isoform. Mutations in these genes have been associated with pachyonychia congenita. In addition, peptides from the C-terminal region of the protein have antimicrobial activity against bacterial pathogens. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL

KRT6A ELISA Kit (Human) (OKEH02048)

OKEH02048 96 Wells
EUR 779
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified, the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. This KRT6 gene in particular encodes the most abundant isoform. Mutations in these genes have been associated with pachyonychia congenita. In addition, peptides from the C-terminal region of the protein have antimicrobial activity against bacterial pathogens. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15 pg/mL

KRT6A ELISA Kit (Mouse) (OKEH05753)

OKEH05753 96 Wells
EUR 779
Description: Description of target: Epidermis-specific type I keratin involved in wound healing.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.4 pg/mL

Human Semaphorin- 6A, SEMA6A ELISA KIT

ELI-52440h 96 Tests
EUR 824

Human Semaphorin 6A(SEMA6A)ELISA Kit

GA-E1104HM-48T 48T
EUR 289

Human Semaphorin 6A(SEMA6A)ELISA Kit

GA-E1104HM-96T 96T
EUR 466

Human Semaphorin 6A (SEMA6A)ELISA Kit

201-12-1088 96 tests
EUR 440
  • This Semaphorin 6A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Semaphorin 6A(SEMA6A)ELISA Kit

QY-E00788 96T
EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-100ug

QP6282-ec-100ug 100ug
EUR 408

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-10ug

QP6282-ec-10ug 10ug
EUR 200

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-1mg

QP6282-ec-1mg 1mg
EUR 1632

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-200ug

QP6282-ec-200ug 200ug
EUR 634

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-500ug

QP6282-ec-500ug 500ug
EUR 1060

Recombinant Human Keratin, type II cytoskeletal 6A Protein, His, E.coli-50ug

QP6282-ec-50ug 50ug
EUR 263

Human OTU Deubiquitinase 6A (OTUD6A) ELISA Kit

abx382000-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KRT6A Antibody

ABD7789 100 ug
EUR 438

KRT6A Antibody

35628-100ul 100ul
EUR 252

KRT6A antibody

70R-18191 50 ul
EUR 435
Description: Rabbit polyclonal KRT6A antibody

KRT6A Antibody

DF7789 200ul
EUR 304
Description: KRT6A Antibody detects endogenous levels of total KRT6A.

KRT6A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

KRT6A Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

KRT6A Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

KRT6A Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

KRT6A Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

KRT6A Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

KRT6A Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT6A. Recognizes KRT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100


PVT17959 2 ug
EUR 231


PVT17963 2 ug
EUR 231


PVT17964 2 ug
EUR 231

Human Keratin 9 ELISA Kit

ELA-E2283h 96 Tests
EUR 824

Human Keratin 8 ELISA Kit

ELA-E2287h 96 Tests
EUR 824

Human Keratin 16 ELISA Kit

ELA-E8852h 96 Tests
EUR 824

Human Keratin 15 ELISA Kit

ELA-E8853h 96 Tests
EUR 824

Human Keratin 12 ELISA Kit

ELA-E8860h 96 Tests
EUR 824

Human Keratin 19 ELISA Kit

ELA-E9126h 96 Tests
EUR 824

Human Keratin 20 ELISA Kit

ELA-E9127h 96 Tests
EUR 824

Human Keratin 13 ELISA Kit

ELA-E9417h 96 Tests
EUR 824

Human KRT6A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KRT6A Recombinant Protein (Human)

RP017380 100 ug Ask for price

KRT6A Recombinant Protein (Human)

RP017383 100 ug Ask for price


6A-100T 100 test
EUR 349

Mouse Semaphorin- 6A, Sema6a ELISA KIT

ELI-52928m 96 Tests
EUR 865

Human Actin like protein 6A(ACTL6A) ELISA kit

E01A1222-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin like protein 6A(ACTL6A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin like protein 6A(ACTL6A) ELISA kit

E01A1222-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin like protein 6A(ACTL6A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin like protein 6A(ACTL6A) ELISA kit

E01A1222-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin like protein 6A(ACTL6A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Lysine- specific demethylase 6A, KDM6A ELISA KIT

ELI-15846h 96 Tests
EUR 824

Human Actin- like protein 6A, ACTL6A ELISA KIT

ELI-35001h 96 Tests
EUR 824

Human Actin-Like Protein 6A (ACTL6A) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Phosphodiesterase 6A, CGMP-Specific (PDE6A) ELISA Kit

abx382127-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit

SEK268Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Actin Like Protein 6A (ACTL6A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Actin Like Protein 6A (ACTL6A) in Tissue homogenates, cell lysates and other biological fluids.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit

SEK268Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Actin Like Protein 6A (ACTL6A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Actin Like Protein 6A (ACTL6A) in Tissue homogenates, cell lysates and other biological fluids.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit

SEK268Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Actin Like Protein 6A (ACTL6A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Actin Like Protein 6A (ACTL6A) in Tissue homogenates, cell lysates and other biological fluids.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit

SEK268Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Actin Like Protein 6A (ACTL6A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Actin Like Protein 6A (ACTL6A) in Tissue homogenates, cell lysates and other biological fluids.

Human Actin Like Protein 6A (ACTL6A) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Actin Like Protein 6A elisa. Alternative names of the recognized antigen: Actl6
  • BAF53A
  • Arp4
  • Baf53a
  • INO80K
  • BAF Complex 53 kDa Subunit
  • 53 kDa BRG1-associated factor A
  • Actin-Related Protein 4
  • INO80 Complex Subunit K
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Actin Like Protein 6A (ACTL6A) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Peptide 6A

H-6905.0005 5.0mg
EUR 297
Description: Sum Formula: C23H43N9O6; CAS# [73549-32-3]

Peptide 6A

H-6905.0025 25.0mg
EUR 1093
Description: Sum Formula: C23H43N9O6; CAS# [73549-32-3]

Semaphorin 6a

GT15056 100 ug
EUR 526

Semaphorin 6a

MO15023 500 ug
EUR 474


TB02758 5mg
EUR 847


TBZ0849 unit Ask for price


TBZ1429 unit Ask for price

KRT6A Conjugated Antibody

C35628 100ul
EUR 397

KRT6A cloning plasmid

CSB-CL012561HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1695
  • Sequence: atggccagcacatccaccaccatcaggagccacagcagcagccgccggggtttcagtgccagctcagccaggctccctggggtcagccgctctggcttcagcagcgtctccgtgtcccgctccaggggcagtggtggcctgggtggtgcatgtggaggagctggctttggcagcc
  • Show more
Description: A cloning plasmid for the KRT6A gene.

KRT6A cloning plasmid

CSB-CL012561HU2-10ug 10ug
EUR 584
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1695
  • Sequence: atggccagcacatccaccaccatcaggagccacagcagcagccgccggggtttcagtgccaactcagccaggctccctggggtcagccgctctggcttcagcagcgtctccgtgtcccgctccaggggcagtggtggcctgggtggtgcatgtggaggagctggctttggcagcc
  • Show more
Description: A cloning plasmid for the KRT6A gene.

Mouse Krt6a Antibody

abx031155-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Krt6a Antibody

abx031155-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human KRT6A(Keratin 6A) ELISA Kit