Human MUC21(Mucin 21) ELISA Kit

Human MUC21(Mucin 21) ELISA Kit

Human Mucin 21 (MUC21) ELISA Kit
RD-MUC21-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Mucin 21 (MUC21) ELISA Kit
RD-MUC21-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Mucin-21 (MUC21) ELISA Kit
20-abx152397	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human MUC21/ Mucin-21 ELISA Kit
E2808Hu	Sunlong	1 Kit	EUR 571

Human MUC21(Mucin-21) ELISA Kit
EH0773	FN Test	96T	EUR 476.25
Detection range: 0.156-10 ng/ml Uniprot ID: Q5SSG8 Alias: MUC21(Mucin-21)/Epiglycanin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Mucin-21 (MUC21) ELISA Kit
abx350081-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Mucin-21 (MUC21) ELISA Kit
abx571364-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Mucin 21(MUC21)ELISA Kit
QY-E00288	Qayee Biotechnology	96T	EUR 394

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
4-SED184Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Mucin 21 elisa. Alternative names of the recognized antigen: C6orf205 Epiglycanin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin 21 (MUC21) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mucin 21 (MUC21) Antibody
20-abx177617	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mucin 21 (MUC21) Antibody
20-abx173626	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Mucin 21 (MUC21)
4-RPD184Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5SSG8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 10.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Mucin 21 expressed in: E.coli

Monkey Mucin-21 (MUC21) ELISA Kit
abx358770-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Chicken Mucin-21 (MUC21) ELISA Kit
abx355863-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Rabbit Mucin-21 (MUC21) ELISA Kit
abx363691-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Mucin-21 (MUC21) ELISA Kit
abx364248-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Human Mucin 21 (MUC21) Protein
20-abx652213	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Mucin 21 (MUC21) CLIA Kit
abx197308-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Mucin-21 (MUC21) CLIA Kit
20-abx494127	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human MUC21 (Mucin 21)
E-EL-H0696	Elabscience Biotech	1 plate of 96 wells	EUR 377
Gentaur's MUC21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MUC21. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MUC21 (Mucin 21) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human MUC21 (Mucin 21)
ELK4073	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mucin 21 (MUC21). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mucin 21 (MUC21). Show more
Description: A sandwich ELISA kit for detection of Mucin 21 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Mucin-21 (MUC21)
KTE61456-48T	Abbkine	48T	EUR 332
MUC21 encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in i Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-21 (MUC21) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-21 (MUC21)
KTE61456-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MUC21 encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in i Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-21 (MUC21) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-21 (MUC21)
KTE61456-96T	Abbkine	96T	EUR 539
MUC21 encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in i Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-21 (MUC21) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human MUC21 (Mucin 21)
E-CL-H0513	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's MUC21 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MUC21 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MUC21 (Mucin 21) in samples from Serum, Plasma, Cell supernatant

Human MUC21 ELISA Kit
ELA-E0210h	Lifescience Market	96 Tests	EUR 824

MUC21 ELISA KIT|Human
EF000501	Lifescience Market	96 Tests	EUR 689

XMIR-21 RNA oligo miRNA-21-5p with Xmotif
XMIR-21	SBI	10 rxn	EUR 438
Category: Exosome

MUC21 ELISA Kit (Human) (OKCD08411)
OKCD08411	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. The encoded protein contains an N-terminal signal sequence, an extracellular mucin domain, a stem domain, a transmembrane domain, and a C-terminal cytoplasmic tail domain. The mucin domain contains O-glycosylation sites and is polymorphic with isoforms containing a variable number of nonidentical proline-, threonine-, and serine-rich tandem repeats of 15 amino acids each. The aberrent expression of this gene is associated with lung adenocarcinoma.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

MUC21 ELISA Kit (Human) (OKEH04157)
OKEH04157	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.98 ng/mL

AXMIR-21 RNA oligo anti-miRNA-21-5p with Xmotif
AXMIR-21	SBI	10 reactions	EUR 438
Category: Exosome

XMIRXpress lentivector miRNA-21-5p with Xmotif
XMIRXP-21	SBI	10 ug	EUR 677
Category: Exosome

MUC21 siRNA
20-abx925022	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human MUC21 shRNA Plasmid
20-abx968050	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MUC21 Recombinant Protein (Human)
RP041476	ABM	100 ug	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

MUC21 cloning plasmid
CSB-CL713107HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1251 Sequence: ATGAAGATGCAGAAAGGAAATGTTCTCCTTATGTTTGGTCTACTATTGCATTTAGAAGCTGCAACAAATTCCAATGAGACTAGCACCTCTGCCAACACTGGATCCAGTGTGATCTCCAGTGGAGCCAGCACAGCCACCAACTCTGGGTCCAGTGTGACCTCCAGTGGGGTCAGCA Show more
Description: A cloning plasmid for the MUC21 gene.

Human Interleukin 21,IL-21 ELISA Kit
201-12-0058	SunredBio	96 tests	EUR 440
This Interleukin 21 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human IL-21(Interleukin-21) ELISA Kit
EH1886	FN Test	96T	EUR 524.1
Detection range: 62.5-4000 pg/ml Uniprot ID: Q9HBE4 Alias: IL-21/Interleukin-21/Za11/IL21
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human Interleukin 21, IL-21 ELISA Kit
CSB-E11707h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 21, IL-21 ELISA Kit
1-CSB-E11707h	Cusabio	EUR 603.00 EUR 4247.00 EUR 2260.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 21(IL-21)ELISA Kit
GA-E0097HM-48T	GenAsia Biotech	48T	EUR 289

Human Interleukin 21(IL-21)ELISA Kit
GA-E0097HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin 21(IL-21)ELISA Kit
QY-E04294	Qayee Biotechnology	96T	EUR 374

MUC21 ORF Vector (Human) (pORF)
ORF013826	ABM	1.0 ug DNA	EUR 95

IgE (Immune globulin E) ELISA test
21	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of IgE (Immune globulin)

ELISA kit for Human IL-21 (Interleukin 21)
E-EL-H2450	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-21. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-21 (Interleukin 21) in samples from Serum, Plasma, Cell supernatant

Human Matrix Metalloproteinase 21(MMP-21)ELISA Kit
QY-E02991	Qayee Biotechnology	96T	EUR 361

Human Interleukin 21 ELISA kit
E01I0028-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 21 ELISA kit
E01I0028-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 21 ELISA kit
E01I0028-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ARPP-21 ELISA KIT|Human
EF007917	Lifescience Market	96 Tests	EUR 689

IL-21 ELISA KIT|Human
EF006004	Lifescience Market	96 Tests	EUR 689

Human IL-21 ELISA Kit
RK00041	Abclonal	96 Tests	EUR 521

Human FGF-21 ELISA Kit
RK00084	Abclonal	96 Tests	EUR 521

Human Mucin 2 ELISA kit
E01M0352-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit
E01M0352-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit
E01M0352-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 17 ELISA Kit
ELA-E0403h	Lifescience Market	96 Tests	EUR 824

Human Gastric Mucin ELISA Kit
ELA-E1335h	Lifescience Market	96 Tests	EUR 824

Human Mucin (MUC) ELISA Kit
20-abx585162	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin (MUC) ELISA Kit
SES095Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
SES095Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
SES095Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
SES095Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
4-SES095Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Mucin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin (MUC) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

IL-21 ELISA Kit| Rat Interleukin-21 ELISA Kit
EF017093	Lifescience Market	96 Tests	EUR 689

IL-21 ELISA Kit| Mouse Interleukin 21 ELISA Kit
EF012880	Lifescience Market	96 Tests	EUR 689

Mouse pre-microRNA Expression Construct mir-21
MMIR-21-PA-1	SBI	Bacterial Streak	EUR 684
Category: MicroRNA Tools

Human fibroblast growth factor-21,FGF-21 ELISA Kit
201-12-1984	SunredBio	96 tests	EUR 440
This fibroblast growth factor-21 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human fibroblast growth factor-21(FGF-21)ELISA Kit
QY-E04013	Qayee Biotechnology	96T	EUR 361

MUC21 sgRNA CRISPR Lentivector set (Human)
K1368201	ABM	3 x 1.0 ug	EUR 339

IL-21/ Rat IL- 21 ELISA Kit
ELA-E1688r	Lifescience Market	96 Tests	EUR 886

Rat Interleukin 21, IL-21 ELISA Kit
CSB-E11843r-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Interleukin 21, IL-21 ELISA Kit
1-CSB-E11843r	Cusabio	EUR 603.00 EUR 4247.00 EUR 2260.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Interleukin 21(IL-21) ELISA Kit
CSB-E13162m-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 21 (IL-21) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Interleukin 21(IL-21) ELISA Kit
1-CSB-E13162m	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 21(IL-21) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse IL-21(Interleukin 21) ELISA Kit
EM0113	FN Test	96T	EUR 524.1
Detection range: 31.25-2000 pg/ml Uniprot ID: Q9ES17 Alias: IL-21/Interleukin-21/Za11/IL21
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Rat IL-21(Interleukin-21) ELISA Kit
ER0161	FN Test	96T	EUR 524.1
Detection range: 15.6-1000 pg/ml Uniprot ID: A3QPB9 Alias: IL-21/Interleukin-21/Za11/IL21
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

Mouse Interleukin 21(IL-21)ELISA Kit
GA-E0627MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Interleukin 21(IL-21)ELISA Kit
GA-E0627MS-96T	GenAsia Biotech	96T	EUR 534

Rat Interleukin 21(IL-21)ELISA Kit
GA-E0133RT-48T	GenAsia Biotech	48T	EUR 317

Rat Interleukin 21(IL-21)ELISA Kit
GA-E0133RT-96T	GenAsia Biotech	96T	EUR 496

Rat Interleukin 21(IL-21)ELISA Kit
QY-E11520	Qayee Biotechnology	96T	EUR 361

Mouse Interleukin 21(IL-21)ELISA Kit
QY-E20849	Qayee Biotechnology	96T	EUR 361

Human Interleukin 21 (IL-21) CLIA Kit
abx195884-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Anti 21-Hydroxylase Antibody (21 OH-Ab) ELISA Kit
abx257329-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Fibroblast Growth Factor 21 (FGF-21) AssayMax ELISA Kit
EF3021-1	AssayPro	96 Well Plate	EUR 417

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ELISA kit for Mouse IL-21 (Interleukin 21)
E-EL-M1273	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-21. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse IL-21 (Interleukin 21) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat IL-21 (Interleukin 21)
E-EL-R0568	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat IL-21. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat IL-21 (Interleukin 21) in samples from Serum, Plasma, Cell supernatant

Human Interleukin 21 (IL21) ELISA Kit
DLR-IL21-Hu-48T	DL Develop	48T	EUR 444
Should the Human Interleukin 21 (IL21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 21 (IL21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
DLR-IL21-Hu-96T	DL Develop	96T	EUR 573
Should the Human Interleukin 21 (IL21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 21 (IL21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interleukin 21, IL21 ELISA Kit
DEIA128	Creative Diagnostics	10 plates	EUR 2495
Description: Human IL-21 ELISA development kit contains the key components required for the quantitative measurement of natural and/or recombinant IL-21 in a sandwich ELISA format within the range of 46-3,000 pg/mL. Using the ELISA protocol described below, this kit provides sufficient reagents to assay IL-21 in approximately 1,000 ELISA plate wells.

Human Interleukin 21, IL21 ELISA Kit
DEIA161	Creative Diagnostics	96T	EUR 740
Description: This assay is a sandwich Enzyme Linked-Immuno-Sorbent Assay(ELISA). It is developed for quantitative measurement of Human IL21 in serum, plasma and other biological fluids.

Human Interferon Alpha 21 ELISA kit
E01I0048-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interferon Alpha 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interferon Alpha 21 ELISA kit
E01I0048-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interferon Alpha 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interferon Alpha 21 ELISA kit
E01I0048-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interferon Alpha 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 21 (IL21) ELISA Kit
20-abx152029	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 21 (IL21) ELISA Kit
abx251202-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Interleukin-21
EK3876	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin-21 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human IL-21
EK0476	SAB	96 tests	EUR 427
Description: Enzyme-linked immunosorbent assay kit for quantification of Human IL-21 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IL21/ Interleukin-21 ELISA Kit
E1280Hu	Sunlong	1 Kit	EUR 571

Human Interleukin- 21, IL21 ELISA KIT
ELI-05506h	Lifescience Market	96 Tests	EUR 824

Human Interleukin 21 (IL21) ELISA Kit
abx574503-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Protocadherin 21(PCDH21)ELISA Kit
QY-E00383	Qayee Biotechnology	96T	EUR 394

Human Interleukin 21 (IL21) ELISA Kit
SEB688Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 (IL21) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 (IL21) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
SEB688Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 (IL21) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 (IL21) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
SEB688Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 (IL21) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 (IL21) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
SEB688Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 (IL21) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 (IL21) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
4-SEB688Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 21 elisa. Alternative names of the recognized antigen: Za11
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 21 (IL21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Interleukin 21 (IL21) ELISA Kit
RDR-IL21-Hu-48Tests	Reddot Biotech	48 Tests	EUR 458

Human Interleukin 21 (IL21) ELISA Kit
RDR-IL21-Hu-96Tests	Reddot Biotech	96 Tests	EUR 633

Human Interleukin 21 (IL21) ELISA Kit
RD-IL21-Hu-48Tests	Reddot Biotech	48 Tests	EUR 439

Human Interleukin 21 (IL21) ELISA Kit
RD-IL21-Hu-96Tests	Reddot Biotech	96 Tests	EUR 606

Human Gastric Mucin,GM ELISA Kit
201-12-1385	SunredBio	96 tests	EUR 440
This Gastric Mucin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mucin-7,MUC7 ELISA Kit
201-12-1614	SunredBio	96 tests	EUR 440
This Mucin-7 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mucin-1,MUC1 ELISA Kit
201-12-1940	SunredBio	96 tests	EUR 440
This Mucin-1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mucin-4,MUC4 ELISA Kit
201-12-1941	SunredBio	96 tests	EUR 440
This Mucin-4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Mucin 1 (MUC1) ELISA Kit
DLR-MUC1-Hu-48T	DL Develop	48T	EUR 441
Should the Human Mucin 1 (MUC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 1 (MUC1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Mucin 1 (MUC1) ELISA Kit
DLR-MUC1-Hu-96T	DL Develop	96T	EUR 570
Should the Human Mucin 1 (MUC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 1 (MUC1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Mucin 17 (MUC17) ELISA Kit
DLR-MUC17-Hu-48T	DL Develop	48T	EUR 479
Should the Human Mucin 17 (MUC17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 17 (MUC17) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Mucin 17 (MUC17) ELISA Kit
DLR-MUC17-Hu-96T	DL Develop	96T	EUR 621
Should the Human Mucin 17 (MUC17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 17 (MUC17) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Mucin 2 (MUC2) ELISA Kit
DLR-MUC2-Hu-48T	DL Develop	48T	EUR 479
Should the Human Mucin 2 (MUC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 2 (MUC2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Mucin 2 (MUC2) ELISA Kit
DLR-MUC2-Hu-96T	DL Develop	96T	EUR 621
Should the Human Mucin 2 (MUC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 2 (MUC2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Mucin 20 (MUC20) ELISA Kit
DLR-MUC20-Hu-48T	DL Develop	48T	EUR 479
Should the Human Mucin 20 (MUC20) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 20 (MUC20) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Mucin 20 (MUC20) ELISA Kit
DLR-MUC20-Hu-96T	DL Develop	96T	EUR 621
Should the Human Mucin 20 (MUC20) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 20 (MUC20) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Mucin 3 (MUC3) ELISA Kit
DLR-MUC3-Hu-48T	DL Develop	48T	EUR 498
Should the Human Mucin 3 (MUC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 3 (MUC3) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Mucin 3 (MUC3) ELISA Kit
DLR-MUC3-Hu-96T	DL Develop	96T	EUR 647
Should the Human Mucin 3 (MUC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 3 (MUC3) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Mucin 4 (MUC4) ELISA Kit
DLR-MUC4-Hu-48T	DL Develop	48T	EUR 498
Should the Human Mucin 4 (MUC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 4 (MUC4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Mucin 4 (MUC4) ELISA Kit
DLR-MUC4-Hu-96T	DL Develop	96T	EUR 647
Should the Human Mucin 4 (MUC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 4 (MUC4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Mucin 6 (MUC6) ELISA Kit
DLR-MUC6-Hu-48T	DL Develop	48T	EUR 498
Should the Human Mucin 6 (MUC6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 6 (MUC6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Mucin 6 (MUC6) ELISA Kit
DLR-MUC6-Hu-96T	DL Develop	96T	EUR 647
Should the Human Mucin 6 (MUC6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 6 (MUC6) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Mucin-13(MUC13) ELISA kit
CSB-EL015217HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-13 (MUC13) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-13(MUC13) ELISA kit
1-CSB-EL015217HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-13(MUC13) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin-15(MUC15) ELISA kit
CSB-EL015218HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-15 (MUC15) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-15(MUC15) ELISA kit
1-CSB-EL015218HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-15(MUC15) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin-19(MUC19) ELISA kit
CSB-EL015221HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-19 (MUC19) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-19(MUC19) ELISA kit
1-CSB-EL015221HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-19(MUC19) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin-3A(MUC3A) ELISA kit
CSB-EL015225HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-3A (MUC3A) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-3A(MUC3A) ELISA kit
1-CSB-EL015225HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-3A(MUC3A) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin-3B(MUC3B) ELISA kit
CSB-EL015226HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-3B (MUC3B) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-3B(MUC3B) ELISA kit
1-CSB-EL015226HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-3B(MUC3B) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin-4(MUC4) ELISA kit
CSB-EL015227HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-4 (MUC4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-4(MUC4) ELISA kit
1-CSB-EL015227HU	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-4(MUC4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Mucin 1,MUC1 ELISA kit
E01M0408-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 1,MUC1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 1,MUC1 ELISA kit
E01M0408-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 1,MUC1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 1,MUC1 ELISA kit
E01M0408-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 1,MUC1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin-2 (MUC2) ELISA Kit
abx055282-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Mucin 17 (MUC17) ELISA Kit
20-abx152394	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin-2 (MUC2) ELISA Kit
20-abx152395	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin 20 (MUC20) ELISA Kit
20-abx152396	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin 3 (MUC3) ELISA Kit
20-abx152398	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin 4 (MUC4) ELISA Kit
20-abx152399	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin 6 (MUC6) ELISA Kit
20-abx152402	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mucin-2 (MUC2) ELISA Kit
abx250256-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Mucin 4 (MUC4) ELISA Kit
abx250412-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Mucin 20 (MUC20) ELISA Kit
abx250484-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Mucin 17 (MUC17) ELISA Kit
abx252787-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Mucin 3 (MUC3) ELISA Kit
abx252788-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Mucin-16 (MUC16) ELISA Kit
abx253494-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human MUC13(Mucin 13) ELISA Kit
EH3395	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q9H3R2 Alias: MUC13/Mucin 13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human MUC17(Mucin 17) ELISA Kit
EH3396	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: Q685J3 Alias: MUC17/Mucin 17
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human MUC3(Mucin 3) ELISA Kit
EH3397	FN Test	96T	EUR 476.25
Detection range: 31.25-2000 pg/ml Alias: MUC3(Mucin 3)/MUC3A/Mucin-3A/Intestinal mucin-3A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human MUC6(Mucin 6) ELISA Kit
EH3398	FN Test	96T	EUR 476.25
Detection range: 0.313-20 ng/ml Uniprot ID: Q6W4X9 Alias: MUC6(Mucin 6)/Gastric mucin-6
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human Mucin-5B
EK2116	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-5B in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Mucin-2
EK2155	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Mucin-5AC
EK2212	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-5AC in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Mucin-4
EK2600	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-4 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Mucin-7
EK3979	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-7 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human MUC1/ Mucin-1 ELISA Kit
E1664Hu	Sunlong	1 Kit	EUR 571

Human MUC12/ Mucin-12 ELISA Kit
E1665Hu	Sunlong	1 Kit	EUR 571

Human MUC15/ Mucin-15 ELISA Kit
E1666Hu	Sunlong	1 Kit	EUR 571

Human MUC16/ Mucin-16 ELISA Kit
E1667Hu	Sunlong	1 Kit	EUR 537

Human MUC17/ Mucin-17 ELISA Kit
E1668Hu	Sunlong	1 Kit	EUR 571

Human MUC2/ Mucin-2 ELISA Kit
E1669Hu	Sunlong	1 Kit	EUR 571

Human MUC21(Mucin 21) ELISA Kit