Human MUC21(Mucin 21) ELISA Kit

Human MUC21(Mucin 21) ELISA Kit

Human Mucin 21 (MUC21) ELISA Kit
RDR-MUC21-Hu-48Tests 48 Tests
EUR 544

Human Mucin 21 (MUC21) ELISA Kit
RDR-MUC21-Hu-96Tests 96 Tests
EUR 756

Human Mucin-21 (MUC21) ELISA Kit
abx571364-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human MUC21/ Mucin-21 ELISA Kit
E2808Hu 1 Kit
EUR 571

Human MUC21(Mucin-21) ELISA Kit
EH0773 96T
EUR 476.25
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q5SSG8
  • Alias: MUC21(Mucin-21)/Epiglycanin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Mucin-21 (MUC21) ELISA Kit
20-abx152397
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mucin-21 (MUC21) ELISA Kit
abx350081-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Mucin 21(MUC21)ELISA Kit
QY-E00288 96T
EUR 394

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
SED184Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin 21 (MUC21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin 21 (MUC21) in serum, plasma, tissue homogenates and other biological fluids.

Human Mucin 21 (MUC21) ELISA Kit
4-SED184Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Mucin 21 elisa. Alternative names of the recognized antigen: C6orf205
  • Epiglycanin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin 21 (MUC21) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mucin 21 (MUC21) Antibody
20-abx173626
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mucin 21 (MUC21) Antibody
20-abx177617
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Recombinant Mucin 21 (MUC21)
4-RPD184Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5SSG8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 10.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Mucin 21 expressed in: E.coli

Rabbit Mucin-21 (MUC21) ELISA Kit
abx363691-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Mucin-21 (MUC21) ELISA Kit
abx364248-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Monkey Mucin-21 (MUC21) ELISA Kit
abx358770-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Chicken Mucin-21 (MUC21) ELISA Kit
abx355863-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Mucin 21 (MUC21) Protein
20-abx652213
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Mucin-21 (MUC21) CLIA Kit
20-abx494127
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Mucin 21 (MUC21) CLIA Kit
abx197308-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Human MUC21 (Mucin 21)
ELK4073 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Mucin 21 (MUC21). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Mucin 21 (MUC21).
  • Show more
Description: A sandwich ELISA kit for detection of Mucin 21 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human MUC21 (Mucin 21)
E-EL-H0696 1 plate of 96 wells
EUR 377
  • Gentaur's MUC21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MUC21. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MUC21 (Mucin 21) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Mucin-21 (MUC21)
KTE61456-48T 48T
EUR 332
  • MUC21 encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in i
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-21 (MUC21) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-21 (MUC21)
KTE61456-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MUC21 encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in i
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-21 (MUC21) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Mucin-21 (MUC21)
KTE61456-96T 96T
EUR 539
  • MUC21 encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in i
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Mucin-21 (MUC21) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human MUC21 (Mucin 21)
E-CL-H0513 1 plate of 96 wells
EUR 584
  • Gentaur's MUC21 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MUC21 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MUC21 (Mucin 21) in samples from Serum, Plasma, Cell supernatant

Human MUC21 ELISA Kit
ELA-E0210h 96 Tests
EUR 824

MUC21 ELISA KIT|Human
EF000501 96 Tests
EUR 689

XMIR-21 RNA oligo miRNA-21-5p with Xmotif
XMIR-21 10 rxn
EUR 438
  • Category: Exosome

MUC21 ELISA Kit (Human) (OKCD08411)
OKCD08411 96 Wells
EUR 975
Description: Description of target: This gene encodes a large membrane-bound glycoprotein which is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. The encoded protein contains an N-terminal signal sequence, an extracellular mucin domain, a stem domain, a transmembrane domain, and a C-terminal cytoplasmic tail domain. The mucin domain contains O-glycosylation sites and is polymorphic with isoforms containing a variable number of nonidentical proline-, threonine-, and serine-rich tandem repeats of 15 amino acids each. The aberrent expression of this gene is associated with lung adenocarcinoma.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

MUC21 ELISA Kit (Human) (OKEH04157)
OKEH04157 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.98 ng/mL

AXMIR-21 RNA oligo anti-miRNA-21-5p with Xmotif
AXMIR-21 10 reactions
EUR 438
  • Category: Exosome

XMIRXpress lentivector miRNA-21-5p with Xmotif
XMIRXP-21 10 ug
EUR 677
  • Category: Exosome

MUC21 siRNA
20-abx925022
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human MUC21 shRNA Plasmid
20-abx968050
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MUC21 Recombinant Protein (Human)
RP041476 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

MUC21 cloning plasmid
CSB-CL713107HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1251
  • Sequence: ATGAAGATGCAGAAAGGAAATGTTCTCCTTATGTTTGGTCTACTATTGCATTTAGAAGCTGCAACAAATTCCAATGAGACTAGCACCTCTGCCAACACTGGATCCAGTGTGATCTCCAGTGGAGCCAGCACAGCCACCAACTCTGGGTCCAGTGTGACCTCCAGTGGGGTCAGCA
  • Show more
Description: A cloning plasmid for the MUC21 gene.

Human IL-21(Interleukin-21) ELISA Kit
EH1886 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
  • Uniprot ID: Q9HBE4
  • Alias: IL-21/Interleukin-21/Za11/IL21
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human Interleukin 21(IL-21)ELISA Kit
GA-E0097HM-48T 48T
EUR 289

Human Interleukin 21(IL-21)ELISA Kit
GA-E0097HM-96T 96T
EUR 466

Human Interleukin 21,IL-21 ELISA Kit
201-12-0058 96 tests
EUR 440
  • This Interleukin 21 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 21, IL-21 ELISA Kit
CSB-E11707h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 21, IL-21 ELISA Kit
1-CSB-E11707h
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 21(IL-21)ELISA Kit
QY-E04294 96T
EUR 374

MUC21 ORF Vector (Human) (pORF)
ORF013826 1.0 ug DNA
EUR 95

IgE (Immune globulin E) ELISA test
21 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of IgE (Immune globulin)

ELISA kit for Human IL-21 (Interleukin 21)
E-EL-H2450 1 plate of 96 wells
EUR 534
  • Gentaur's IL-21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-21. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-21 (Interleukin 21) in samples from Serum, Plasma, Cell supernatant

Human Matrix Metalloproteinase 21(MMP-21)ELISA Kit
QY-E02991 96T
EUR 361

Human Interleukin 21 ELISA kit
E01I0028-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 21 ELISA kit
E01I0028-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 21 ELISA kit
E01I0028-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

IL-21 ELISA KIT|Human
EF006004 96 Tests
EUR 689

ARPP-21 ELISA KIT|Human
EF007917 96 Tests
EUR 689

Human IL-21 ELISA Kit
RK00041 96 Tests
EUR 521

Human FGF-21 ELISA Kit
RK00084 96 Tests
EUR 521

Human Mucin (MUC) ELISA Kit
20-abx585162
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mucin 2 ELISA kit
E01M0352-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit
E01M0352-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 2 ELISA kit
E01M0352-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 4 ELISA kit
E01M0353-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 7 ELISA kit
E01M0354-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mucin 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 5B ELISA kit
E01M0358-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 5B in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 17 ELISA Kit
ELA-E0403h 96 Tests
EUR 824

Human Gastric Mucin ELISA Kit
ELA-E1335h 96 Tests
EUR 824

Human Mucin (MUC) ELISA Kit
SES095Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
SES095Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
SES095Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
SES095Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Mucin (MUC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Mucin (MUC) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Mucin (MUC) ELISA Kit
4-SES095Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Mucin elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Mucin (MUC) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

IL-21 ELISA Kit| Rat Interleukin-21 ELISA Kit
EF017093 96 Tests
EUR 689

IL-21 ELISA Kit| Mouse Interleukin 21 ELISA Kit
EF012880 96 Tests
EUR 689

Mouse pre-microRNA Expression Construct mir-21
MMIR-21-PA-1 Bacterial Streak
EUR 684
  • Category: MicroRNA Tools

Human fibroblast growth factor-21,FGF-21 ELISA Kit
201-12-1984 96 tests
EUR 440
  • This fibroblast growth factor-21 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human fibroblast growth factor-21(FGF-21)ELISA Kit
QY-E04013 96T
EUR 361

MUC21 sgRNA CRISPR Lentivector set (Human)
K1368201 3 x 1.0 ug
EUR 339

IL-21/ Rat IL- 21 ELISA Kit
ELA-E1688r 96 Tests
EUR 886

Mouse Interleukin 21(IL-21)ELISA Kit 　 　
GA-E0627MS-48T 48T
EUR 336

Mouse Interleukin 21(IL-21)ELISA Kit 　 　
GA-E0627MS-96T 96T
EUR 534

Rat Interleukin 21(IL-21)ELISA Kit
GA-E0133RT-48T 48T
EUR 317

Rat Interleukin 21(IL-21)ELISA Kit
GA-E0133RT-96T 96T
EUR 496

Rat IL-21(Interleukin-21) ELISA Kit
ER0161 96T
EUR 524.1
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: A3QPB9
  • Alias: IL-21/Interleukin-21/Za11/IL21
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 9.375pg/ml

Mouse IL-21(Interleukin 21) ELISA Kit
EM0113 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q9ES17
  • Alias: IL-21/Interleukin-21/Za11/IL21
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Rat Interleukin 21, IL-21 ELISA Kit
CSB-E11843r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Interleukin 21, IL-21 ELISA Kit
1-CSB-E11843r
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 21, IL-21 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Interleukin 21(IL-21) ELISA Kit
CSB-E13162m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 21 (IL-21) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Interleukin 21(IL-21) ELISA Kit
1-CSB-E13162m
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 21(IL-21) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Interleukin 21(IL-21)ELISA Kit
QY-E11520 96T
EUR 361

Mouse Interleukin 21(IL-21)ELISA Kit
QY-E20849 96T
EUR 361

Human Interleukin 21 (IL-21) CLIA Kit
abx195884-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Fibroblast Growth Factor 21 (FGF-21) AssayMax ELISA Kit
EF3021-1 96 Well Plate
EUR 417

Human Anti 21-Hydroxylase Antibody (21 OH-Ab) ELISA Kit
abx257329-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ELISA kit for Mouse IL-21 (Interleukin 21)
E-EL-M1273 1 plate of 96 wells
EUR 534
  • Gentaur's IL-21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse IL-21. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse IL-21 (Interleukin 21) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat IL-21 (Interleukin 21)
E-EL-R0568 1 plate of 96 wells
EUR 534
  • Gentaur's IL-21 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat IL-21. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat IL-21 (Interleukin 21) in samples from Serum, Plasma, Cell supernatant

Human Interleukin 21 (IL21) ELISA Kit
abx574503-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Interferon Alpha 21 ELISA kit
E01I0048-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interferon Alpha 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interferon Alpha 21 ELISA kit
E01I0048-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interferon Alpha 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interferon Alpha 21 ELISA kit
E01I0048-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Interferon Alpha 21 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Interleukin-21
EK3876 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Interleukin-21 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human IL-21
EK0476 96 tests
EUR 427
Description: Enzyme-linked immunosorbent assay kit for quantification of Human IL-21 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human IL21/ Interleukin-21 ELISA Kit
E1280Hu 1 Kit
EUR 571

Human Interleukin- 21, IL21 ELISA KIT
ELI-05506h 96 Tests
EUR 824

Human Interleukin 21 (IL21) ELISA Kit
20-abx152029
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 21 (IL21) ELISA Kit
abx251202-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Interleukin 21 (IL21) ELISA Kit
DLR-IL21-Hu-48T 48T
EUR 444
  • Should the Human Interleukin 21 (IL21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 21 (IL21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
DLR-IL21-Hu-96T 96T
EUR 573
  • Should the Human Interleukin 21 (IL21) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 21 (IL21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interleukin 21, IL21 ELISA Kit
DEIA128 10 plates
EUR 2495
Description: Human IL-21 ELISA development kit contains the key components required for the quantitative measurement of natural and/or recombinant IL-21 in a sandwich ELISA format within the range of 46-3,000 pg/mL. Using the ELISA protocol described below, this kit provides sufficient reagents to assay IL-21 in approximately 1,000 ELISA plate wells.

Human Interleukin 21, IL21 ELISA Kit
DEIA161 96T
EUR 740
Description: This assay is a sandwich Enzyme Linked-Immuno-Sorbent Assay(ELISA). It is developed for quantitative measurement of Human IL21 in serum, plasma and other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
SEB688Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 (IL21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 (IL21) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
SEB688Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 (IL21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 (IL21) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
SEB688Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 (IL21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 (IL21) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
SEB688Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 21 (IL21) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 21 (IL21) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 21 (IL21) ELISA Kit
4-SEB688Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 21 elisa. Alternative names of the recognized antigen: Za11
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 21 (IL21) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Interleukin 21 (IL21) ELISA Kit
RD-IL21-Hu-48Tests 48 Tests
EUR 439

Human Interleukin 21 (IL21) ELISA Kit
RD-IL21-Hu-96Tests 96 Tests
EUR 606

Human Interleukin 21 (IL21) ELISA Kit
RDR-IL21-Hu-48Tests 48 Tests
EUR 458

Human Interleukin 21 (IL21) ELISA Kit
RDR-IL21-Hu-96Tests 96 Tests
EUR 633

Human Protocadherin 21(PCDH21)ELISA Kit
QY-E00383 96T
EUR 394

Human Mucin 20 (MUC20) ELISA Kit
abx571306-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Mucin 4 (MUC4) ELISA Kit
abx572034-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Mucin-2 (MUC2) ELISA Kit
20-abx572107
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Mucin-17 (MUC17) ELISA Kit
abx574598-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Mucin-3A (MUC3A) ELISA Kit
abx575985-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Mucin 1,MUC1 ELISA kit
E01M0408-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 1,MUC1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 1,MUC1 ELISA kit
E01M0408-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 1,MUC1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mucin 1,MUC1 ELISA kit
E01M0408-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mucin 1,MUC1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Mucin-5B
EK2116 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-5B in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Mucin-2
EK2155 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Mucin-5AC
EK2212 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-5AC in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Mucin-4
EK2600 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-4 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Mucin-7
EK3979 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Mucin-7 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human MUC1/ Mucin-1 ELISA Kit
E1664Hu 1 Kit
EUR 571

Human MUC12/ Mucin-12 ELISA Kit
E1665Hu 1 Kit
EUR 571

Human MUC15/ Mucin-15 ELISA Kit
E1666Hu 1 Kit
EUR 571

Human MUC16/ Mucin-16 ELISA Kit
E1667Hu 1 Kit
EUR 537

Human MUC17/ Mucin-17 ELISA Kit
E1668Hu 1 Kit
EUR 571

Human MUC2/ Mucin-2 ELISA Kit
E1669Hu 1 Kit
EUR 571

Human MUC20/ Mucin-20 ELISA Kit
E1670Hu 1 Kit
EUR 571

Human MUC3A/ Mucin-3A ELISA Kit
E1671Hu 1 Kit
EUR 571

Human MUC4/ Mucin-4 ELISA Kit
E1672Hu 1 Kit
EUR 571

Human MUC5AC/ Mucin-5AC ELISA Kit
E1673Hu 1 Kit
EUR 571

Human MUC5B/ Mucin-5B ELISA Kit
E1674Hu 1 Kit
EUR 571

Human MUC7/ Mucin-7 ELISA Kit
E1675Hu 1 Kit
EUR 571

Human MUC5B(Mucin-5B) ELISA Kit
EH1005 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q9HC84
  • Alias: MUC5B/MUC5/MUC-5B/Sublingual gland mucin/Mucin-5 subtype B, tracheobronchial/Cervical mucin/High molecular weight salivary mucin MG1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human MUC2(Mucin-2) ELISA Kit
EH1017 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q02817
  • Alias: MUC2(Mucin-2)/MLP/MUC-2/SMUC
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human MUC5AC(Mucin-5AC) ELISA Kit
EH1035 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P98088
  • Alias: MUC5AC(Mucin-5AC)/MUC5/MUC-5AC/TBM/LeB/Tracheobronchial mucin/Mucin-5 subtype AC, tracheobronchial/Major airway glycoprotein/Gastric mucin/Lewis B blood group antigen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human MUC4(Mucin-4) ELISA Kit
EH1160 96T
EUR 476.25
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q99102
  • Alias: MUC4(Mucin-4)/ASGP/Ascites sialoglycoprotein/mucin 4, cell surface associated/mucin 4, tracheobronchial/Pancreatic adenocarcinoma mucin/Testis mucin/Tracheobronchial mucin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human MUC15(Mucin-15) ELISA Kit
EH1209 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q8N387
  • Alias: MUC15/Mucin-15/MUC-15
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human MUC20(Mucin-20) ELISA Kit
EH1227 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8N307
  • Alias: MUC20(Mucin-20)/MUC-20
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human MUC12(Mucin-12) ELISA Kit
EH1230 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q9UKN1
  • Alias: MUC12(Mucin-12)/MUC11/Mucin-11/MUC-11/MUC-12
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human MUC7(Mucin-7) ELISA Kit
EH1942 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q8TAX7
  • Alias: MUC7/MG2/MUC-7/Apo-MG2/Salivary mucin-7
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human MUC13(Mucin 13) ELISA Kit
EH3395 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9H3R2
  • Alias: MUC13/Mucin 13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human MUC17(Mucin 17) ELISA Kit
EH3396 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q685J3
  • Alias: MUC17/Mucin 17
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human MUC3(Mucin 3) ELISA Kit
EH3397 96T
EUR 476.25
  • Detection range: 31.25-2000 pg/ml
  • Alias: MUC3(Mucin 3)/MUC3A/Mucin-3A/Intestinal mucin-3A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human MUC6(Mucin 6) ELISA Kit
EH3398 96T
EUR 476.25
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q6W4X9
  • Alias: MUC6(Mucin 6)/Gastric mucin-6
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Mucin- 13, MUC13 ELISA KIT
ELI-12939h 96 Tests
EUR 824

Human Mucin- 5B, MUC5B ELISA KIT
ELI-02378h 96 Tests
EUR 824

Human Mucin- 2, MUC2 ELISA KIT
ELI-02458h 96 Tests
EUR 824

Human Mucin- 5AC, MUC5AC ELISA KIT
ELI-02595h 96 Tests
EUR 824

Human Mucin- 3A, MUC3A ELISA KIT
ELI-03319h 96 Tests
EUR 824

Human Mucin- 4, MUC4 ELISA KIT
ELI-03327h 96 Tests
EUR 824

Human Mucin- 15, MUC15 ELISA KIT
ELI-03499h 96 Tests
EUR 824

Human Mucin- 20, MUC20 ELISA KIT
ELI-03544h 96 Tests
EUR 824

Human Mucin- 12, MUC12 ELISA KIT
ELI-03553h 96 Tests
EUR 824

Human Mucin- 7, MUC7 ELISA KIT
ELI-05843h 96 Tests
EUR 824

Human Mucin- 19, MUC19 ELISA KIT
ELI-15972h 96 Tests
EUR 824

Human Mucin- 6, MUC6 ELISA KIT
ELI-15973h 96 Tests
EUR 824

Human Gastric Mucin(GM)ELISA Kit
GA-E1401HM-48T 48T
EUR 289

Human Gastric Mucin(GM)ELISA Kit
GA-E1401HM-96T 96T
EUR 466

Human Mucin-7(MUC7)ELISA Kit
GA-E1630HM-48T 48T
EUR 289

Human Mucin-7(MUC7)ELISA Kit
GA-E1630HM-96T 96T
EUR 466

Human Mucin-1(MUC1)ELISA Kit
GA-E1956HM-48T 48T
EUR 289

Human Mucin-1(MUC1)ELISA Kit
GA-E1956HM-96T 96T
EUR 466

Human Mucin-4(MUC4)ELISA Kit
GA-E1957HM-48T 48T
EUR 289

Human Mucin-4(MUC4)ELISA Kit
GA-E1957HM-96T 96T
EUR 466

Human Mucin- 3B, MUC3B ELISA KIT
ELI-37510h 96 Tests
EUR 824

Human Mucin 17 (MUC17) ELISA Kit
20-abx152394
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mucin-2 (MUC2) ELISA Kit
20-abx152395
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mucin 20 (MUC20) ELISA Kit
20-abx152396
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human MUC21(Mucin 21) ELISA Kit