Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit

Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
RD-NUMA1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
RD-NUMA1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Nuclear Mitotic Apparatus Protein 1,NUMA1 ELISA Kit
201-12-3209	SunredBio	96 tests	EUR 440
This Nuclear Mitotic Apparatus Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
20-abx152571	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
abx252822-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
abx252838-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit
EH3450	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q14980 Alias: NUMA1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Nuclear mitotic apparatus protein 1, NUMA1 ELISA KIT
ELI-44881h	Lifescience Market	96 Tests	EUR 824

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
abx571325-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Nuclear Mitotic Apparatus Protein 1(NUMA1)ELISA Kit
QY-E03825	Qayee Biotechnology	96T	EUR 361

Human Nuclear Mitotic Apparatus Protein 1 ELISA Kit (NUMA1)
RK01976	Abclonal	96 Tests	EUR 521

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
SEC332Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
SEC332Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
SEC332Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
SEC332Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
4-SEC332Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Nuclear Mitotic Apparatus Protein 1 elisa. Alternative names of the recognized antigen: NMP22 NUMA Nuclear matrix protein-22 SP-H antigen
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody
20-abx114180	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody
20-abx128970	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody
abx122642-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody
abx145485-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody
20-abx173866	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody
abx330645-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody
20-abx324768	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody
20-abx338488	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody
20-abx000744	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Nuclear Mitotic Apparatus Protein 1 (NUMA1)
4-RPC332Hu01	Cloud-Clone	EUR 501.41 EUR 237.00 EUR 1605.28 EUR 601.76 EUR 1103.52 EUR 398.00 EUR 3863.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q14980 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 48.7kDa Isoelectric Point: 10.2
Description: Recombinant Human Nuclear Mitotic Apparatus Protein 1 expressed in: E.coli

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) Protein
20-abx166132	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pig Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
abx360882-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
abx358906-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
abx355632-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
abx363581-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit
abx364278-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Mouse Nuclear Mitotic Apparatus Protein 1(NUMA1)ELISA Kit
GA-E0853MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Nuclear Mitotic Apparatus Protein 1(NUMA1)ELISA Kit
GA-E0853MS-96T	GenAsia Biotech	96T	EUR 534

Rat Nuclear Mitotic AppaRatus Protein 1(NUMA1)ELISA Kit
QY-E10566	Qayee Biotechnology	96T	EUR 361

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) CLIA Kit
abx197366-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) CLIA Kit
20-abx493622	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human NUMA1 (Nuclear Mitotic Apparatus Protein 1)
ELK3987	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nuclear Mitotic Apparatus Protein 1 (NUMA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody sp Show more
Description: A sandwich ELISA kit for detection of Nuclear Mitotic Apparatus Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody (HRP)
20-abx336844	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody (FITC)
20-abx336845	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody (Biotin)
20-abx336846	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human)
4-PAC332Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUMA1 (Phe1700~His2115) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1)

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human)
4-MAC332Hu22	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Phe1700~His2115 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1)

CLIA kit for Human NUMA1 (Nuclear Mitotic Apparatus Protein 1)
E-CL-H1406	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's NUMA1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human NUMA1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human NUMA1 (Nuclear Mitotic Apparatus Protein 1) in samples from Serum, Plasma, Cell supernatant

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), APC
4-PAC332Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUMA1 (Phe1700~His2115) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), Biotinylated
4-PAC332Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUMA1 (Phe1700~His2115) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Biotin.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), Cy3
4-PAC332Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUMA1 (Phe1700~His2115) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Cy3.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), FITC
4-PAC332Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUMA1 (Phe1700~His2115) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with FITC.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), HRP
4-PAC332Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUMA1 (Phe1700~His2115) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with HRP.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), PE
4-PAC332Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUMA1 (Phe1700~His2115) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with PE.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), APC
4-MAC332Hu22-APC	Cloud-Clone	EUR 358.00 EUR 3455.00 EUR 957.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Phe1700~His2115 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), Biotinylated
4-MAC332Hu22-Biotin	Cloud-Clone	EUR 320.00 EUR 2592.00 EUR 760.00 EUR 394.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Phe1700~His2115 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Biotin.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), Cy3
4-MAC332Hu22-Cy3	Cloud-Clone	EUR 435.00 EUR 4565.00 EUR 1235.00 EUR 569.00 EUR 258.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Phe1700~His2115 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Cy3.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), FITC
4-MAC332Hu22-FITC	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Phe1700~His2115 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with FITC.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), HRP
4-MAC332Hu22-HRP	Cloud-Clone	EUR 327.00 EUR 3011.00 EUR 846.00 EUR 413.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Phe1700~His2115 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with HRP.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), PE
4-MAC332Hu22-PE	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Phe1700~His2115 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with PE.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), APC-Cy7
4-PAC332Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUMA1 (Phe1700~His2115) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC-Cy7.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), APC-Cy7
4-MAC332Hu22-APC-Cy7	Cloud-Clone	EUR 596.00 EUR 6790.00 EUR 1795.00 EUR 796.00 EUR 329.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Phe1700~His2115 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC-Cy7.

Mouse Nuclear Mitotic AppaMouseus Protein 1(NUMA1)ELISA Kit
QY-E21102	Qayee Biotechnology	96T	EUR 361

Nuclear Mitotic Apparatus Protein (NUMA) Antibody
20-abx133724	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein (NuMA) Antibody
abx235912-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Nuclear Mitotic Apparatus Protein (NuMA); Clone A73-B/D12 (Concentrate)
RA0251-C.1	ScyTek Laboratories	0.1 ml	EUR 125

Anti-Nuclear Mitotic Apparatus Protein (NuMA) Monoclonal Antibody
M02018	BosterBio	100ug/vial	EUR 397
Description: Mouse Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody. Validated in IHC and tested in Human.

Human Mitotic spindle apparatus antibody ELISA kit
E01M0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitotic spindle apparatus antibody ELISA kit
E01M0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitotic spindle apparatus antibody ELISA kit
E01M0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Nuclear Mitotic Apparatus Protein Antibody Clone SPM300, Unconjugated-100ug
4926-MSM1X-P1	EnQuireBio	100ug	EUR 428

Nuclear Mitotic Apparatus Protein (NuMA); Clone A73-B/D12 (Concentrate)
RA0251-C.5	ScyTek Laboratories	0.5 ml	EUR 300

Rat Mitotic spindle apparatus antibody ELISA kit
E02M0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mitotic spindle apparatus antibody ELISA kit
E02M0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mitotic spindle apparatus antibody ELISA kit
E02M0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mitotic spindle apparatus antibody ELISA kit
E04M0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mitotic spindle apparatus antibody ELISA kit
E04M0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mitotic spindle apparatus antibody ELISA kit
E04M0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mitotic spindle apparatus antibody ELISA kit
E03M0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mitotic spindle apparatus antibody ELISA kit
E03M0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mitotic spindle apparatus antibody ELISA kit
E03M0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mitotic spindle apparatus antibody ELISA kit
E06M0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mitotic spindle apparatus antibody ELISA kit
E06M0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mitotic spindle apparatus antibody ELISA kit
E06M0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mitotic spindle apparatus antibody ELISA kit
E08M0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mitotic spindle apparatus antibody ELISA kit
E08M0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mitotic spindle apparatus antibody ELISA kit
E08M0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitotic spindle apparatus antibody ELISA kit
E07M0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitotic spindle apparatus antibody ELISA kit
E07M0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitotic spindle apparatus antibody ELISA kit
E07M0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mitotic spindle apparatus antibody ELISA kit
E09M0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mitotic spindle apparatus antibody ELISA kit
E09M0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mitotic spindle apparatus antibody ELISA kit
E09M0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human mitotic spindle apparatus antibody,MSA ELISA Kit
201-12-0529	SunredBio	96 tests	EUR 440
This mitotic spindle apparatus antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human mitotic spindle apparatus antibody,MSA ELISA Kit
CN-03838H1	ChemNorm	96T	EUR 467

Human mitotic spindle apparatus antibody,MSA ELISA Kit
CN-03838H2	ChemNorm	48T	EUR 316

Human mitotic spindle apparatus antibody(MSA)ELISA Kit
GA-E0545HM-48T	GenAsia Biotech	48T	EUR 289

Human mitotic spindle apparatus antibody(MSA)ELISA Kit
GA-E0545HM-96T	GenAsia Biotech	96T	EUR 466

Human mitotic spindle apparatus antibody(MSA)ELISA Kit
QY-E02657	Qayee Biotechnology	96T	EUR 361

Guinea pig Mitotic spindle apparatus antibody ELISA kit
E05M0342-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mitotic spindle apparatus antibody ELISA kit
E05M0342-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mitotic spindle apparatus antibody ELISA kit
E05M0342-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Anti-Nuclear Mitotic Apparatus Protein Antibody Clone A73-B/D12, Unconjugated-100ug
4926-MSM1-P1	EnQuireBio	100ug	EUR 428

Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - With BSA and Azide, Clone: SPM300
AMM01159G	Leading Biology	0.05mg	EUR 396
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - With BSA and Azide. The antibodies are raised in Mouse and are from clone SPM300. This antibody is applicable in IHC, IF, FC

Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - Without BSA and Azide, Clone: SPM300
AMM01160G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - Without BSA and Azide. The antibodies are raised in Mouse and are from clone SPM300. This antibody is applicable in IHC, IF, FC

NUMA1 ELISA KIT|Human
EF008781	Lifescience Market	96 Tests	EUR 689

Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - With BSA and Azide, Clone: A73-B/D12
AMM01157G	Leading Biology	0.05mg	EUR 396
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - With BSA and Azide. The antibodies are raised in Mouse and are from clone A73-B/D12. This antibody is applicable in IHC, IF, FC

Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - Without BSA and Azide, Clone: A73-B/D12
AMM01158G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - Without BSA and Azide. The antibodies are raised in Mouse and are from clone A73-B/D12. This antibody is applicable in IHC, IF, FC

ELISA kit for Human Golgi apparatus protein 1
EK3366	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi apparatus protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GLG1/ Golgi apparatus protein 1 ELISA Kit
E1014Hu	Sunlong	1 Kit	EUR 605

Human Golgi Apparatus Protein 1 (GLG1) ELISA Kit
abx555387-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Human Golgi apparatus protein 1, GLG1 ELISA KIT
ELI-39078h	Lifescience Market	96 Tests	EUR 824

NUMA1 ELISA Kit (Human) (OKAN06158)
OKAN06158	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.060 ng/mL

NUMA1 ELISA Kit (Human) (OKCD08089)
OKCD08089	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: NuMA is a structural element in maintaining nuclear integrity. A critical spindle pole-associated mechanism, called the END (Emi1/NuMA/dynein-dynactin) network, spatially restricts APC/C activity in early mitosis. The entire coding region and exon-intron boundaries of NuMa were screened in 92 familial breast cancer patients. But the results do not support the role of NuMA variants as breast cancer susceptibility alleles.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL

NUMA1 ELISA Kit (Human) (OKDD00441)
OKDD00441	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.056 ng/mL

Chicken Golgi apparatus protein 1, GLG1 ELISA KIT
ELI-31586c	Lifescience Market	96 Tests	EUR 928

Chicken Golgi Apparatus Protein 1 (GLG1) ELISA Kit
abx555342-96tests	Abbexa	96 tests	EUR 911
Shipped within 1-3 weeks.

Mouse Golgi Apparatus Protein 1 (GLG1) ELISA Kit
abx556067-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Rat Golgi Apparatus Protein 1 (GLG1) ELISA Kit
abx556215-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse Golgi apparatus protein 1, Glg1 ELISA KIT
ELI-48301m	Lifescience Market	96 Tests	EUR 865

Rat Golgi apparatus protein 1, Glg1 ELISA KIT
ELI-48470r	Lifescience Market	96 Tests	EUR 886

Human Mitotic- spindle organizing protein 1, MZT1 ELISA KIT
ELI-38376h	Lifescience Market	96 Tests	EUR 824

Human MAD1L1(Mitotic arrest deficient 1-like protein 1) ELISA Kit
EH14839	FN Test	96T	EUR 524.1
Detection range: 31.2-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Golgi Apparatus Protein 1 (GLG1) Antibody
20-abx125879	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Golgi Apparatus Protein 1 (GLG1) Antibody
abx034536-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Golgi Apparatus Protein 1 (GLG1) Antibody
abx034536-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Human Mitotic checkpoint protein BUB3, BUB3 ELISA KIT
ELI-25359h	Lifescience Market	96 Tests	EUR 824

Human Mitotic Checkpoint Protein BUB3 (BUB3) ELISA Kit
20-abx386102	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Mouse Mitotic- spindle organizing protein 1, Mzt1 ELISA KIT
ELI-13220m	Lifescience Market	96 Tests	EUR 865

NUMA1 antibody
70R-18997	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NUMA1 antibody

NUMA1 Antibody
34869-100ul	SAB	100ul	EUR 252

NUMA1 Antibody
34869-50ul	SAB	50ul	EUR 187

NUMA1 Antibody
CSB-PA114858-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NUMA1 Antibody
CSB-PA114858-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NUMA1 Antibody
DF4249	Affbiotech	200ul	EUR 304
Description: NUMA1 Antibody detects endogenous levels of total NUMA1.

NUMA1 Antibody
1-CSB-PA016185GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NUMA1 Antibody
1-CSB-PA016185YA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NUMA1 antibody
70R-8922	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal NUMA1 antibody

NUMA1 Antibody
1-CSB-PA020178	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

NUMA1 siRNA
20-abx926609	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUMA1 Antibody
ABD4249	Lifescience Market	100 ug	EUR 438

pOTB7-NUMA1
PVT18619	Lifescience Market	2 ug	EUR 258

anti-NUMA1
YF-PA27312	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NUMA1

Human Nuclear protein 1, NUPR1 ELISA KIT
ELI-13386h	Lifescience Market	96 Tests	EUR 824

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone SX53G8 (Concentrate)
RA0077-C.1	ScyTek Laboratories	0.1 ml	EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone KP10 (Concentrate)
RA0080-C.1	ScyTek Laboratories	0.1 ml	EUR 125

p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone SPM348 (Concentrate)
RA0474-C.1	ScyTek Laboratories	0.1 ml	EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone SPM308 (Concentrate)
RA0476-C.1	ScyTek Laboratories	0.1 ml	EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone 57P06 (Concentrate)
RA0478-C.1	ScyTek Laboratories	0.1 ml	EUR 125

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human anti-golgi apparatus antibody,AGAA ELISA Kit
201-12-0496	SunredBio	96 tests	EUR 440
This anti-golgi apparatus antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human anti-golgi apparatus antibody,AGAA ELISA Kit
CN-03870H1	ChemNorm	96T	EUR 457

Human anti-golgi apparatus antibody,AGAA ELISA Kit
CN-03870H2	ChemNorm	48T	EUR 306

Human anti-golgi apparatus antibody(AGAA)ELISA Kit
GA-E0512HM-48T	GenAsia Biotech	48T	EUR 289

Human anti-golgi apparatus antibody(AGAA)ELISA Kit
GA-E0512HM-96T	GenAsia Biotech	96T	EUR 466

Human anti-golgi apparatus antibody(AGAA)ELISA Kit
QY-E02642	Qayee Biotechnology	96T	EUR 361

Human NUMA1 shRNA Plasmid
20-abx953276	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit
SEP874Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	Ask for price
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids.

for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit
SEP874Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	Ask for price
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids.

for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit
SEP874Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	Ask for price
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids.

for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit
SEP874Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	Ask for price
The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)
4-SEP874Hu	Cloud-Clone	Ask for price Ask for price Ask for price	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Mitotic Arrest Deficient 1 Like Protein 1 elisa. Alternative names of the recognized antigen: HsMAD1 MAD1 PIG9 TP53I9 TXBP181 Mitotic spindle assembly checkpoint protein MAD1 Mitotic checkpoint MAD1 protein homolog Tax-binding pr Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Mitotic- spindle organizing protein 2B, MZT2B ELISA KIT
ELI-13898h	Lifescience Market	96 Tests	EUR 824

Human Mitotic- spindle organizing protein 2A, MZT2A ELISA KIT
ELI-36851h	Lifescience Market	96 Tests	EUR 824

p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone KIP1/769 (Concentrate)
RA0078-C.1	ScyTek Laboratories	0.1 ml	EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone KIP2/880 (Concentrate)
RA0081-C.1	ScyTek Laboratories	0.1 ml	EUR 125

Human Mitotic Arrest Deficient 2 Like 1 (MAD2L1) ELISA Kit
abx388369-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Nuclear Receptor Interacting Protein 1 ELISA kit
E01N0045-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear Receptor Interacting Protein 1 ELISA kit
E01N0045-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear Receptor Interacting Protein 1 ELISA kit
E01N0045-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thymocyte nuclear protein 1(THYN1) ELISA kit
E01T0692-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thymocyte nuclear protein 1(THYN1) ELISA kit
E01T0692-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thymocyte nuclear protein 1(THYN1) ELISA kit
E01T0692-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thymocyte nuclear protein 1, THYN1 ELISA KIT
ELI-51973h	Lifescience Market	96 Tests	EUR 824

Human Thymocyte Nuclear Protein 1 (THYN1) ELISA Kit
abx383753-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

NUMA1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1467102	ABM	1.0 ug DNA	EUR 154

NUMA1 Rabbit pAb
A0527-100ul	Abclonal	100 ul	EUR 308

NUMA1 Rabbit pAb
A0527-200ul	Abclonal	200 ul	EUR 459

NUMA1 Rabbit pAb
A0527-20ul	Abclonal	20 ul	EUR 183

NUMA1 Rabbit pAb
A0527-50ul	Abclonal	50 ul	EUR 223

NUMA1 Blocking Peptide
33R-1455	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUMA1 antibody, catalog no. 70R-8922

NUMA1 Blocking Peptide
DF4249-BP	Affbiotech	1mg	EUR 195

NUMA1 Conjugated Antibody
C34869	SAB	100ul	EUR 397

NUMA1 cloning plasmid
CSB-CL016185HU1-10ug	Cusabio	10ug	EUR 1267
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3582 Sequence: atggctgccaccagcaaagaggtggcccgcttggagaccttggtgcgcaaggcaggtgagcagcaggaaacagcctcccgggagttagtcaaggagcctgcgagggcaggagacagacagcccgagtggctggaagagcaacagggacgccagttctgcagcacacaggcagcgc Show more
Description: A cloning plasmid for the NUMA1 gene.

NUMA1 cloning plasmid
CSB-CL016185HU2-10ug	Cusabio	10ug	EUR 933
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2940 Sequence: atgacactccacgccacccggggggctgcactcctctcttgggtgaacagtctacacgtggctgaccctgtggaggctgtgctgcagctccaggactgcagcatcttcatcaagatcattgacagaatccatggcactgaagagggacagcaaatcttgaagcagccggtgtcag Show more
Description: A cloning plasmid for the NUMA1 gene.

Anti-NUMA1 antibody
STJ24848	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants.

Mouse Mitotic checkpoint protein BUB3, Bub3 ELISA KIT
ELI-11201m	Lifescience Market	96 Tests	EUR 865

Bovine Mitotic checkpoint protein BUB3, BUB3 ELISA KIT
ELI-50146b	Lifescience Market	96 Tests	EUR 928

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone DCS-72.F6 (Concentrate)
RA0079-C.1	ScyTek Laboratories	0.1 ml	EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone KP10 & KIP2/880 (Concentrate)
RA0477-C.1	ScyTek Laboratories	0.1 ml	EUR 125

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human Mitotic Spindle Assembly Checkpoint Protein MAD1 (MAD1L1) ELISA Kit
20-abx385115	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Nuclear protein 1, Nupr1 ELISA KIT
ELI-36782m	Lifescience Market	96 Tests	EUR 865

HeLa Nuclear Extract
1641-1	Biovision		EUR 338

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1	AssayPro	96 Well Plate	EUR 477

NUMA1 ORF Vector (Human) (pORF)
ORF007297	ABM	1.0 ug DNA	EUR 95

NUMA1 ORF Vector (Human) (pORF)
ORF007298	ABM	1.0 ug DNA	EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

NUMA1 Protein Vector (Human) (pPB-C-His)
PV029185	ABM	500 ng	EUR 329

NUMA1 Protein Vector (Human) (pPB-N-His)
PV029186	ABM	500 ng	EUR 329

NUMA1 Protein Vector (Human) (pPM-C-HA)
PV029187	ABM	500 ng	EUR 329

NUMA1 Protein Vector (Human) (pPM-C-His)
PV029188	ABM	500 ng	EUR 329

Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit