Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
RD-NUMA1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
RD-NUMA1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Nuclear Mitotic Apparatus Protein 1,NUMA1 ELISA Kit |
201-12-3209 |
SunredBio |
96 tests |
EUR 440 |
- This Nuclear Mitotic Apparatus Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
20-abx152571 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
abx252822-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
abx252838-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit |
EH3450 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q14980
- Alias: NUMA1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Nuclear mitotic apparatus protein 1, NUMA1 ELISA KIT |
ELI-44881h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
abx571325-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Nuclear Mitotic Apparatus Protein 1(NUMA1)ELISA Kit |
QY-E03825 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Nuclear Mitotic Apparatus Protein 1 ELISA Kit (NUMA1) |
RK01976 |
Abclonal |
96 Tests |
EUR 521 |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
SEC332Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
SEC332Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
SEC332Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
SEC332Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
4-SEC332Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Nuclear Mitotic Apparatus Protein 1 elisa. Alternative names of the recognized antigen: NMP22
- NUMA
- Nuclear matrix protein-22
- SP-H antigen
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody |
20-abx114180 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody |
20-abx128970 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody |
abx122642-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody |
abx145485-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody |
20-abx173866 |
Abbexa |
-
EUR 342.00
-
EUR 857.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody |
abx330645-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody |
20-abx324768 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody |
20-abx338488 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody |
20-abx000744 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Recombinant Nuclear Mitotic Apparatus Protein 1 (NUMA1) |
4-RPC332Hu01 |
Cloud-Clone |
-
EUR 501.41
-
EUR 237.00
-
EUR 1605.28
-
EUR 601.76
-
EUR 1103.52
-
EUR 398.00
-
EUR 3863.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q14980
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 48.7kDa
- Isoelectric Point: 10.2
|
Description: Recombinant Human Nuclear Mitotic Apparatus Protein 1 expressed in: E.coli |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) Protein |
20-abx166132 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pig Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
abx360882-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
abx358906-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Chicken Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
abx355632-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
abx363581-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit |
abx364278-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Mouse Nuclear Mitotic Apparatus Protein 1(NUMA1)ELISA Kit |
GA-E0853MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse Nuclear Mitotic Apparatus Protein 1(NUMA1)ELISA Kit |
GA-E0853MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
Rat Nuclear Mitotic AppaRatus Protein 1(NUMA1)ELISA Kit |
QY-E10566 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) CLIA Kit |
abx197366-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) CLIA Kit |
20-abx493622 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human NUMA1 (Nuclear Mitotic Apparatus Protein 1) |
ELK3987 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nuclear Mitotic Apparatus Protein 1 (NUMA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody sp
- Show more
|
Description: A sandwich ELISA kit for detection of Nuclear Mitotic Apparatus Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody (HRP) |
20-abx336844 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody (FITC) |
20-abx336845 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody (Biotin) |
20-abx336846 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human) |
4-PAC332Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUMA1 (Phe1700~His2115)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human) |
4-MAC332Hu22 |
Cloud-Clone |
-
EUR 255.00
-
EUR 2642.00
-
EUR 655.00
-
EUR 322.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Phe1700~His2115
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) |
CLIA kit for Human NUMA1 (Nuclear Mitotic Apparatus Protein 1) |
E-CL-H1406 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's NUMA1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human NUMA1 . Standards or samples are added to the micro CLIA plate wells and combined with th
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human NUMA1 (Nuclear Mitotic Apparatus Protein 1) in samples from Serum, Plasma, Cell supernatant |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), APC |
4-PAC332Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUMA1 (Phe1700~His2115)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), Biotinylated |
4-PAC332Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUMA1 (Phe1700~His2115)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Biotin. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), Cy3 |
4-PAC332Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUMA1 (Phe1700~His2115)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Cy3. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), FITC |
4-PAC332Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUMA1 (Phe1700~His2115)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with FITC. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), HRP |
4-PAC332Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUMA1 (Phe1700~His2115)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with HRP. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), PE |
4-PAC332Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUMA1 (Phe1700~His2115)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with PE. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), APC |
4-MAC332Hu22-APC |
Cloud-Clone |
-
EUR 358.00
-
EUR 3455.00
-
EUR 957.00
-
EUR 458.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Phe1700~His2115
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), Biotinylated |
4-MAC332Hu22-Biotin |
Cloud-Clone |
-
EUR 320.00
-
EUR 2592.00
-
EUR 760.00
-
EUR 394.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Phe1700~His2115
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Biotin. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), Cy3 |
4-MAC332Hu22-Cy3 |
Cloud-Clone |
-
EUR 435.00
-
EUR 4565.00
-
EUR 1235.00
-
EUR 569.00
-
EUR 258.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Phe1700~His2115
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Cy3. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), FITC |
4-MAC332Hu22-FITC |
Cloud-Clone |
-
EUR 306.00
-
EUR 2784.00
-
EUR 786.00
-
EUR 386.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Phe1700~His2115
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with FITC. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), HRP |
4-MAC332Hu22-HRP |
Cloud-Clone |
-
EUR 327.00
-
EUR 3011.00
-
EUR 846.00
-
EUR 413.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Phe1700~His2115
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with HRP. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), PE |
4-MAC332Hu22-PE |
Cloud-Clone |
-
EUR 306.00
-
EUR 2784.00
-
EUR 786.00
-
EUR 386.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Phe1700~His2115
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with PE. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC332Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NUMA1 (Phe1700~His2115)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC-Cy7. |
Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), APC-Cy7 |
4-MAC332Hu22-APC-Cy7 |
Cloud-Clone |
-
EUR 596.00
-
EUR 6790.00
-
EUR 1795.00
-
EUR 796.00
-
EUR 329.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Phe1700~His2115
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC-Cy7. |
Mouse Nuclear Mitotic AppaMouseus Protein 1(NUMA1)ELISA Kit |
QY-E21102 |
Qayee Biotechnology |
96T |
EUR 361 |
Nuclear Mitotic Apparatus Protein (NUMA) Antibody |
20-abx133724 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Nuclear Mitotic Apparatus Protein (NuMA) Antibody |
abx235912-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Nuclear Mitotic Apparatus Protein (NuMA); Clone A73-B/D12 (Concentrate) |
RA0251-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
Anti-Nuclear Mitotic Apparatus Protein (NuMA) Monoclonal Antibody |
M02018 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Mouse Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody. Validated in IHC and tested in Human. |
Human Mitotic spindle apparatus antibody ELISA kit |
E01M0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Mitotic spindle apparatus antibody ELISA kit |
E01M0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Mitotic spindle apparatus antibody ELISA kit |
E01M0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Anti-Nuclear Mitotic Apparatus Protein Antibody Clone SPM300, Unconjugated-100ug |
4926-MSM1X-P1 |
EnQuireBio |
100ug |
EUR 428 |
Nuclear Mitotic Apparatus Protein (NuMA); Clone A73-B/D12 (Concentrate) |
RA0251-C.5 |
ScyTek Laboratories |
0.5 ml |
EUR 300 |
Rat Mitotic spindle apparatus antibody ELISA kit |
E02M0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Mitotic spindle apparatus antibody ELISA kit |
E02M0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Mitotic spindle apparatus antibody ELISA kit |
E02M0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mitotic spindle apparatus antibody ELISA kit |
E04M0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mitotic spindle apparatus antibody ELISA kit |
E04M0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Mitotic spindle apparatus antibody ELISA kit |
E04M0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mitotic spindle apparatus antibody ELISA kit |
E03M0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mitotic spindle apparatus antibody ELISA kit |
E03M0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Mitotic spindle apparatus antibody ELISA kit |
E03M0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Mitotic spindle apparatus antibody ELISA kit |
E06M0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Mitotic spindle apparatus antibody ELISA kit |
E06M0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Mitotic spindle apparatus antibody ELISA kit |
E06M0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Mitotic spindle apparatus antibody ELISA kit |
E08M0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Mitotic spindle apparatus antibody ELISA kit |
E08M0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Mitotic spindle apparatus antibody ELISA kit |
E08M0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Mitotic spindle apparatus antibody ELISA kit |
E07M0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Mitotic spindle apparatus antibody ELISA kit |
E07M0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Mitotic spindle apparatus antibody ELISA kit |
E07M0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Mitotic spindle apparatus antibody ELISA kit |
E09M0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Mitotic spindle apparatus antibody ELISA kit |
E09M0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Mitotic spindle apparatus antibody ELISA kit |
E09M0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human mitotic spindle apparatus antibody,MSA ELISA Kit |
201-12-0529 |
SunredBio |
96 tests |
EUR 440 |
- This mitotic spindle apparatus antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human mitotic spindle apparatus antibody,MSA ELISA Kit |
CN-03838H1 |
ChemNorm |
96T |
EUR 467 |
Human mitotic spindle apparatus antibody,MSA ELISA Kit |
CN-03838H2 |
ChemNorm |
48T |
EUR 316 |
Human mitotic spindle apparatus antibody(MSA)ELISA Kit |
GA-E0545HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human mitotic spindle apparatus antibody(MSA)ELISA Kit |
GA-E0545HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human mitotic spindle apparatus antibody(MSA)ELISA Kit |
QY-E02657 |
Qayee Biotechnology |
96T |
EUR 361 |
Guinea pig Mitotic spindle apparatus antibody ELISA kit |
E05M0342-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Mitotic spindle apparatus antibody ELISA kit |
E05M0342-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Mitotic spindle apparatus antibody ELISA kit |
E05M0342-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Anti-Nuclear Mitotic Apparatus Protein Antibody Clone A73-B/D12, Unconjugated-100ug |
4926-MSM1-P1 |
EnQuireBio |
100ug |
EUR 428 |
Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - With BSA and Azide, Clone: SPM300 |
AMM01159G |
Leading Biology |
0.05mg |
EUR 396 |
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - With BSA and Azide. The antibodies are raised in Mouse and are from clone SPM300. This antibody is applicable in IHC, IF, FC |
Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - Without BSA and Azide, Clone: SPM300 |
AMM01160G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - Without BSA and Azide. The antibodies are raised in Mouse and are from clone SPM300. This antibody is applicable in IHC, IF, FC |
Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - With BSA and Azide, Clone: A73-B/D12 |
AMM01157G |
Leading Biology |
0.05mg |
EUR 396 |
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - With BSA and Azide. The antibodies are raised in Mouse and are from clone A73-B/D12. This antibody is applicable in IHC, IF, FC |
Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - Without BSA and Azide, Clone: A73-B/D12 |
AMM01158G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - Without BSA and Azide. The antibodies are raised in Mouse and are from clone A73-B/D12. This antibody is applicable in IHC, IF, FC |
ELISA kit for Human Golgi apparatus protein 1 |
EK3366 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi apparatus protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human GLG1/ Golgi apparatus protein 1 ELISA Kit |
E1014Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Golgi Apparatus Protein 1 (GLG1) ELISA Kit |
abx555387-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 1-3 weeks.
|
Human Golgi apparatus protein 1, GLG1 ELISA KIT |
ELI-39078h |
Lifescience Market |
96 Tests |
EUR 824 |
NUMA1 ELISA Kit (Human) (OKAN06158) |
OKAN06158 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.060 ng/mL |
NUMA1 ELISA Kit (Human) (OKCD08089) |
OKCD08089 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: NuMA is a structural element in maintaining nuclear integrity. A critical spindle pole-associated mechanism, called the END (Emi1/NuMA/dynein-dynactin) network, spatially restricts APC/C activity in early mitosis. The entire coding region and exon-intron boundaries of NuMa were screened in 92 familial breast cancer patients. But the results do not support the role of NuMA variants as breast cancer susceptibility alleles.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL |
NUMA1 ELISA Kit (Human) (OKDD00441) |
OKDD00441 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.056 ng/mL |
Chicken Golgi apparatus protein 1, GLG1 ELISA KIT |
ELI-31586c |
Lifescience Market |
96 Tests |
EUR 928 |
Chicken Golgi Apparatus Protein 1 (GLG1) ELISA Kit |
abx555342-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 1-3 weeks.
|
Mouse Golgi Apparatus Protein 1 (GLG1) ELISA Kit |
abx556067-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Rat Golgi Apparatus Protein 1 (GLG1) ELISA Kit |
abx556215-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 1-3 weeks.
|
Mouse Golgi apparatus protein 1, Glg1 ELISA KIT |
ELI-48301m |
Lifescience Market |
96 Tests |
EUR 865 |
Rat Golgi apparatus protein 1, Glg1 ELISA KIT |
ELI-48470r |
Lifescience Market |
96 Tests |
EUR 886 |
Human Mitotic- spindle organizing protein 1, MZT1 ELISA KIT |
ELI-38376h |
Lifescience Market |
96 Tests |
EUR 824 |
Human MAD1L1(Mitotic arrest deficient 1-like protein 1) ELISA Kit |
EH14839 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.2-2000 pg/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Golgi Apparatus Protein 1 (GLG1) Antibody |
20-abx125879 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Golgi Apparatus Protein 1 (GLG1) Antibody |
abx034536-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Golgi Apparatus Protein 1 (GLG1) Antibody |
abx034536-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Human Mitotic checkpoint protein BUB3, BUB3 ELISA KIT |
ELI-25359h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Mitotic Checkpoint Protein BUB3 (BUB3) ELISA Kit |
20-abx386102 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Mouse Mitotic- spindle organizing protein 1, Mzt1 ELISA KIT |
ELI-13220m |
Lifescience Market |
96 Tests |
EUR 865 |
NUMA1 antibody |
70R-18997 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NUMA1 antibody |
NUMA1 Antibody |
34869-100ul |
SAB |
100ul |
EUR 252 |
NUMA1 Antibody |
34869-50ul |
SAB |
50ul |
EUR 187 |
NUMA1 Antibody |
CSB-PA114858- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
NUMA1 Antibody |
CSB-PA114858-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
NUMA1 Antibody |
DF4249 |
Affbiotech |
200ul |
EUR 304 |
Description: NUMA1 Antibody detects endogenous levels of total NUMA1. |
NUMA1 Antibody |
1-CSB-PA016185GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
NUMA1 Antibody |
1-CSB-PA016185YA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
NUMA1 antibody |
70R-8922 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal NUMA1 antibody |
NUMA1 Antibody |
1-CSB-PA020178 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000 |
NUMA1 siRNA |
20-abx926609 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NUMA1 |
YF-PA27312 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NUMA1 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone SX53G8 (Concentrate) |
RA0077-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone KP10 (Concentrate) |
RA0080-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone SPM348 (Concentrate) |
RA0474-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone SPM308 (Concentrate) |
RA0476-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone 57P06 (Concentrate) |
RA0478-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human anti-golgi apparatus antibody,AGAA ELISA Kit |
201-12-0496 |
SunredBio |
96 tests |
EUR 440 |
- This anti-golgi apparatus antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human anti-golgi apparatus antibody,AGAA ELISA Kit |
CN-03870H1 |
ChemNorm |
96T |
EUR 457 |
Human anti-golgi apparatus antibody,AGAA ELISA Kit |
CN-03870H2 |
ChemNorm |
48T |
EUR 306 |
Human anti-golgi apparatus antibody(AGAA)ELISA Kit |
GA-E0512HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human anti-golgi apparatus antibody(AGAA)ELISA Kit |
GA-E0512HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human NUMA1 shRNA Plasmid |
20-abx953276 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit |
SEP874Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
Ask for price |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids. |
for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit |
SEP874Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
Ask for price |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids. |
for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit |
SEP874Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
Ask for price |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids. |
for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit |
SEP874Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
Ask for price |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids. |
ELISA Kit for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) |
4-SEP874Hu |
Cloud-Clone |
-
Ask for price
-
Ask for price
-
Ask for price
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Mitotic Arrest Deficient 1 Like Protein 1 elisa. Alternative names of the recognized antigen: HsMAD1
- MAD1
- PIG9
- TP53I9
- TXBP181
- Mitotic spindle assembly checkpoint protein MAD1
- Mitotic checkpoint MAD1 protein homolog
- Tax-binding pr
- Show more
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Mitotic- spindle organizing protein 2B, MZT2B ELISA KIT |
ELI-13898h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Mitotic- spindle organizing protein 2A, MZT2A ELISA KIT |
ELI-36851h |
Lifescience Market |
96 Tests |
EUR 824 |
p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone KIP1/769 (Concentrate) |
RA0078-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone KIP2/880 (Concentrate) |
RA0081-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
Human Mitotic Arrest Deficient 2 Like 1 (MAD2L1) ELISA Kit |
abx388369-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Nuclear Receptor Interacting Protein 1 ELISA kit |
E01N0045-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Nuclear Receptor Interacting Protein 1 ELISA kit |
E01N0045-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Nuclear Receptor Interacting Protein 1 ELISA kit |
E01N0045-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thymocyte nuclear protein 1(THYN1) ELISA kit |
E01T0692-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thymocyte nuclear protein 1(THYN1) ELISA kit |
E01T0692-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thymocyte nuclear protein 1(THYN1) ELISA kit |
E01T0692-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thymocyte nuclear protein 1, THYN1 ELISA KIT |
ELI-51973h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Thymocyte Nuclear Protein 1 (THYN1) ELISA Kit |
abx383753-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
NUMA1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1467102 |
ABM |
1.0 ug DNA |
EUR 154 |
NUMA1 Rabbit pAb |
A0527-100ul |
Abclonal |
100 ul |
EUR 308 |
NUMA1 Rabbit pAb |
A0527-200ul |
Abclonal |
200 ul |
EUR 459 |
NUMA1 Rabbit pAb |
A0527-20ul |
Abclonal |
20 ul |
EUR 183 |
NUMA1 Rabbit pAb |
A0527-50ul |
Abclonal |
50 ul |
EUR 223 |
NUMA1 Blocking Peptide |
33R-1455 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUMA1 antibody, catalog no. 70R-8922 |
NUMA1 Blocking Peptide |
DF4249-BP |
Affbiotech |
1mg |
EUR 195 |
NUMA1 Conjugated Antibody |
C34869 |
SAB |
100ul |
EUR 397 |
NUMA1 cloning plasmid |
CSB-CL016185HU1-10ug |
Cusabio |
10ug |
EUR 1267 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3582
- Sequence: atggctgccaccagcaaagaggtggcccgcttggagaccttggtgcgcaaggcaggtgagcagcaggaaacagcctcccgggagttagtcaaggagcctgcgagggcaggagacagacagcccgagtggctggaagagcaacagggacgccagttctgcagcacacaggcagcgc
- Show more
|
Description: A cloning plasmid for the NUMA1 gene. |
NUMA1 cloning plasmid |
CSB-CL016185HU2-10ug |
Cusabio |
10ug |
EUR 933 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2940
- Sequence: atgacactccacgccacccggggggctgcactcctctcttgggtgaacagtctacacgtggctgaccctgtggaggctgtgctgcagctccaggactgcagcatcttcatcaagatcattgacagaatccatggcactgaagagggacagcaaatcttgaagcagccggtgtcag
- Show more
|
Description: A cloning plasmid for the NUMA1 gene. |
Anti-NUMA1 antibody |
STJ24848 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants. |
Mouse Mitotic checkpoint protein BUB3, Bub3 ELISA KIT |
ELI-11201m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Mitotic checkpoint protein BUB3, BUB3 ELISA KIT |
ELI-50146b |
Lifescience Market |
96 Tests |
EUR 928 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone DCS-72.F6 (Concentrate) |
RA0079-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone KP10 & KIP2/880 (Concentrate) |
RA0477-C.1 |
ScyTek Laboratories |
0.1 ml |
EUR 125 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human Mitotic Spindle Assembly Checkpoint Protein MAD1 (MAD1L1) ELISA Kit |
20-abx385115 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
HeLa Nuclear Extract |
1641-1 |
Biovision |
|
EUR 338 |
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit |
EK2802-1 |
AssayPro |
96 Well Plate |
EUR 477 |
NUMA1 ORF Vector (Human) (pORF) |
ORF007297 |
ABM |
1.0 ug DNA |
EUR 95 |
NUMA1 ORF Vector (Human) (pORF) |
ORF007298 |
ABM |
1.0 ug DNA |
EUR 95 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
NUMA1 Protein Vector (Human) (pPB-C-His) |
PV029185 |
ABM |
500 ng |
EUR 329 |
NUMA1 Protein Vector (Human) (pPB-N-His) |
PV029186 |
ABM |
500 ng |
EUR 329 |
NUMA1 Protein Vector (Human) (pPM-C-HA) |
PV029187 |
ABM |
500 ng |
EUR 329 |
NUMA1 Protein Vector (Human) (pPM-C-His) |
PV029188 |
ABM |
500 ng |
EUR 329 |
Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit