
Human brain gene expression atlas project

Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit

Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

RD-NUMA1-Hu-48Tests 48 Tests
EUR 521

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

RD-NUMA1-Hu-96Tests 96 Tests
EUR 723

Human Nuclear Mitotic Apparatus Protein 1,NUMA1 ELISA Kit

201-12-3209 96 tests
EUR 440
  • This Nuclear Mitotic Apparatus Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

abx252822-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

abx252838-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit

EH3450 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q14980
  • Alias: NUMA1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Nuclear mitotic apparatus protein 1, NUMA1 ELISA KIT

ELI-44881h 96 Tests
EUR 824

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

abx571325-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Nuclear Mitotic Apparatus Protein 1(NUMA1)ELISA Kit

QY-E03825 96T
EUR 361

Human Nuclear Mitotic Apparatus Protein 1 ELISA Kit (NUMA1)

RK01976 96 Tests
EUR 521

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

SEC332Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

SEC332Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

SEC332Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

SEC332Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in serum, plasma, tissue homogenates and other biological fluids.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nuclear Mitotic Apparatus Protein 1 elisa. Alternative names of the recognized antigen: NMP22
  • NUMA
  • Nuclear matrix protein-22
  • SP-H antigen
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody

abx122642-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody

abx145485-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody

abx330645-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Nuclear Mitotic Apparatus Protein 1 (NUMA1)

  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q14980
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.7kDa
  • Isoelectric Point: 10.2
Description: Recombinant Human Nuclear Mitotic Apparatus Protein 1 expressed in: E.coli

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pig Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

abx360882-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

abx358906-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

abx355632-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

abx363581-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Nuclear Mitotic Apparatus Protein 1 (NUMA1) ELISA Kit

abx364278-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse Nuclear Mitotic Apparatus Protein 1(NUMA1)ELISA Kit

GA-E0853MS-48T 48T
EUR 336

Mouse Nuclear Mitotic Apparatus Protein 1(NUMA1)ELISA Kit

GA-E0853MS-96T 96T
EUR 534

Rat Nuclear Mitotic AppaRatus Protein 1(NUMA1)ELISA Kit

QY-E10566 96T
EUR 361

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) CLIA Kit

abx197366-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Nuclear Mitotic Apparatus Protein 1 (NUMA1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human NUMA1 (Nuclear Mitotic Apparatus Protein 1)

ELK3987 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nuclear Mitotic Apparatus Protein 1 (NUMA1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody sp
  • Show more
Description: A sandwich ELISA kit for detection of Nuclear Mitotic Apparatus Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUMA1 (Phe1700~His2115)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1)

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Phe1700~His2115
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1)

CLIA kit for Human NUMA1 (Nuclear Mitotic Apparatus Protein 1)

E-CL-H1406 1 plate of 96 wells
EUR 584
  • Gentaur's NUMA1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human NUMA1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human NUMA1 (Nuclear Mitotic Apparatus Protein 1) in samples from Serum, Plasma, Cell supernatant

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUMA1 (Phe1700~His2115)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUMA1 (Phe1700~His2115)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Biotin.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUMA1 (Phe1700~His2115)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Cy3.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUMA1 (Phe1700~His2115)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with FITC.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUMA1 (Phe1700~His2115)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with HRP.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUMA1 (Phe1700~His2115)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with PE.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), APC

  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Phe1700~His2115
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), Biotinylated

  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Phe1700~His2115
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Biotin.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), Cy3

  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Phe1700~His2115
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with Cy3.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), FITC

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Phe1700~His2115
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with FITC.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), HRP

  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Phe1700~His2115
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with HRP.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), PE

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Phe1700~His2115
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with PE.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUMA1 (Phe1700~His2115)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC-Cy7.

Nuclear Mitotic Apparatus Protein 1 (NUMA1) Monoclonal Antibody (Human), APC-Cy7

  • EUR 596.00
  • EUR 6790.00
  • EUR 1795.00
  • EUR 796.00
  • EUR 329.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Phe1700~His2115
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Nuclear Mitotic Apparatus Protein 1 (NUMA1). This antibody is labeled with APC-Cy7.

Mouse Nuclear Mitotic AppaMouseus Protein 1(NUMA1)ELISA Kit

QY-E21102 96T
EUR 361

Nuclear Mitotic Apparatus Protein (NUMA) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Nuclear Mitotic Apparatus Protein (NuMA) Antibody

abx235912-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Nuclear Mitotic Apparatus Protein (NuMA); Clone A73-B/D12 (Concentrate)

RA0251-C.1 0.1 ml
EUR 125

Anti-Nuclear Mitotic Apparatus Protein (NuMA) Monoclonal Antibody

M02018 100ug/vial
EUR 397
Description: Mouse Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody. Validated in IHC and tested in Human.

Human Mitotic spindle apparatus antibody ELISA kit

E01M0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitotic spindle apparatus antibody ELISA kit

E01M0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitotic spindle apparatus antibody ELISA kit

E01M0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-Nuclear Mitotic Apparatus Protein Antibody Clone SPM300, Unconjugated-100ug

4926-MSM1X-P1 100ug
EUR 428

Nuclear Mitotic Apparatus Protein (NuMA); Clone A73-B/D12 (Concentrate)

RA0251-C.5 0.5 ml
EUR 300

Rat Mitotic spindle apparatus antibody ELISA kit

E02M0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mitotic spindle apparatus antibody ELISA kit

E02M0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mitotic spindle apparatus antibody ELISA kit

E02M0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mitotic spindle apparatus antibody ELISA kit

E04M0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mitotic spindle apparatus antibody ELISA kit

E04M0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Mitotic spindle apparatus antibody ELISA kit

E04M0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mitotic spindle apparatus antibody ELISA kit

E03M0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mitotic spindle apparatus antibody ELISA kit

E03M0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Mitotic spindle apparatus antibody ELISA kit

E03M0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mitotic spindle apparatus antibody ELISA kit

E06M0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mitotic spindle apparatus antibody ELISA kit

E06M0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Mitotic spindle apparatus antibody ELISA kit

E06M0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mitotic spindle apparatus antibody ELISA kit

E08M0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mitotic spindle apparatus antibody ELISA kit

E08M0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Mitotic spindle apparatus antibody ELISA kit

E08M0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitotic spindle apparatus antibody ELISA kit

E07M0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitotic spindle apparatus antibody ELISA kit

E07M0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitotic spindle apparatus antibody ELISA kit

E07M0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mitotic spindle apparatus antibody ELISA kit

E09M0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mitotic spindle apparatus antibody ELISA kit

E09M0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Mitotic spindle apparatus antibody ELISA kit

E09M0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human mitotic spindle apparatus antibody,MSA ELISA Kit

201-12-0529 96 tests
EUR 440
  • This mitotic spindle apparatus antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human mitotic spindle apparatus antibody,MSA ELISA Kit

CN-03838H1 96T
EUR 467

Human mitotic spindle apparatus antibody,MSA ELISA Kit

CN-03838H2 48T
EUR 316

Human mitotic spindle apparatus antibody(MSA)ELISA Kit

GA-E0545HM-48T 48T
EUR 289

Human mitotic spindle apparatus antibody(MSA)ELISA Kit

GA-E0545HM-96T 96T
EUR 466

Human mitotic spindle apparatus antibody(MSA)ELISA Kit

QY-E02657 96T
EUR 361

Guinea pig Mitotic spindle apparatus antibody ELISA kit

E05M0342-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mitotic spindle apparatus antibody ELISA kit

E05M0342-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Mitotic spindle apparatus antibody ELISA kit

E05M0342-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Mitotic spindle apparatus antibody in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Anti-Nuclear Mitotic Apparatus Protein Antibody Clone A73-B/D12, Unconjugated-100ug

4926-MSM1-P1 100ug
EUR 428

Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - With BSA and Azide, Clone: SPM300

AMM01159G 0.05mg
EUR 396
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - With BSA and Azide. The antibodies are raised in Mouse and are from clone SPM300. This antibody is applicable in IHC, IF, FC

Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - Without BSA and Azide, Clone: SPM300

AMM01160G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - Without BSA and Azide. The antibodies are raised in Mouse and are from clone SPM300. This antibody is applicable in IHC, IF, FC


EF008781 96 Tests
EUR 689

Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - With BSA and Azide, Clone: A73-B/D12

AMM01157G 0.05mg
EUR 396
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - With BSA and Azide. The antibodies are raised in Mouse and are from clone A73-B/D12. This antibody is applicable in IHC, IF, FC

Monoclonal Nuclear Mitotic Apparatus Protein (NuMA) Antibody - Without BSA and Azide, Clone: A73-B/D12

AMM01158G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human Nuclear Mitotic Apparatus Protein (NuMA) - Without BSA and Azide. The antibodies are raised in Mouse and are from clone A73-B/D12. This antibody is applicable in IHC, IF, FC

ELISA kit for Human Golgi apparatus protein 1

EK3366 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi apparatus protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GLG1/ Golgi apparatus protein 1 ELISA Kit

E1014Hu 1 Kit
EUR 605

Human Golgi Apparatus Protein 1 (GLG1) ELISA Kit

abx555387-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.

Human Golgi apparatus protein 1, GLG1 ELISA KIT

ELI-39078h 96 Tests
EUR 824

NUMA1 ELISA Kit (Human) (OKAN06158)

OKAN06158 96 Wells
EUR 792
Description: Description of target: This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.060 ng/mL

NUMA1 ELISA Kit (Human) (OKCD08089)

OKCD08089 96 Wells
EUR 975
Description: Description of target: NuMA is a structural element in maintaining nuclear integrity. A critical spindle pole-associated mechanism, called the END (Emi1/NuMA/dynein-dynactin) network, spatially restricts APC/C activity in early mitosis. The entire coding region and exon-intron boundaries of NuMa were screened in 92 familial breast cancer patients. But the results do not support the role of NuMA variants as breast cancer susceptibility alleles.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL

NUMA1 ELISA Kit (Human) (OKDD00441)

OKDD00441 96 Wells
EUR 975
Description: Description of target: This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.056 ng/mL

Chicken Golgi apparatus protein 1, GLG1 ELISA KIT

ELI-31586c 96 Tests
EUR 928

Chicken Golgi Apparatus Protein 1 (GLG1) ELISA Kit

abx555342-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Mouse Golgi Apparatus Protein 1 (GLG1) ELISA Kit

abx556067-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Rat Golgi Apparatus Protein 1 (GLG1) ELISA Kit

abx556215-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Golgi apparatus protein 1, Glg1 ELISA KIT

ELI-48301m 96 Tests
EUR 865

Rat Golgi apparatus protein 1, Glg1 ELISA KIT

ELI-48470r 96 Tests
EUR 886

Human Mitotic- spindle organizing protein 1, MZT1 ELISA KIT

ELI-38376h 96 Tests
EUR 824

Human MAD1L1(Mitotic arrest deficient 1-like protein 1) ELISA Kit

EH14839 96T
EUR 524.1
  • Detection range: 31.2-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Golgi Apparatus Protein 1 (GLG1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Golgi Apparatus Protein 1 (GLG1) Antibody

abx034536-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Golgi Apparatus Protein 1 (GLG1) Antibody

abx034536-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human Mitotic checkpoint protein BUB3, BUB3 ELISA KIT

ELI-25359h 96 Tests
EUR 824

Human Mitotic Checkpoint Protein BUB3 (BUB3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Mitotic- spindle organizing protein 1, Mzt1 ELISA KIT

ELI-13220m 96 Tests
EUR 865

NUMA1 antibody

70R-18997 50 ul
EUR 435
Description: Rabbit polyclonal NUMA1 antibody

NUMA1 Antibody

34869-100ul 100ul
EUR 252

NUMA1 Antibody

34869-50ul 50ul
EUR 187

NUMA1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NUMA1 Antibody

CSB-PA114858-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NUMA1 Antibody

DF4249 200ul
EUR 304
Description: NUMA1 Antibody detects endogenous levels of total NUMA1.

NUMA1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NUMA1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NUMA1 antibody

70R-8922 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal NUMA1 antibody

NUMA1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NUMA1. Recognizes NUMA1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUMA1 Antibody

ABD4249 100 ug
EUR 438


PVT18619 2 ug
EUR 258


YF-PA27312 50 ug
EUR 363
Description: Mouse polyclonal to NUMA1

Human Nuclear protein 1, NUPR1 ELISA KIT

ELI-13386h 96 Tests
EUR 824

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone SX53G8 (Concentrate)

RA0077-C.1 0.1 ml
EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone KP10 (Concentrate)

RA0080-C.1 0.1 ml
EUR 125

p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone SPM348 (Concentrate)

RA0474-C.1 0.1 ml
EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone SPM308 (Concentrate)

RA0476-C.1 0.1 ml
EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone 57P06 (Concentrate)

RA0478-C.1 0.1 ml
EUR 125

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human anti-golgi apparatus antibody,AGAA ELISA Kit

201-12-0496 96 tests
EUR 440
  • This anti-golgi apparatus antibody ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human anti-golgi apparatus antibody,AGAA ELISA Kit

CN-03870H1 96T
EUR 457

Human anti-golgi apparatus antibody,AGAA ELISA Kit

CN-03870H2 48T
EUR 306

Human anti-golgi apparatus antibody(AGAA)ELISA Kit

GA-E0512HM-48T 48T
EUR 289

Human anti-golgi apparatus antibody(AGAA)ELISA Kit

GA-E0512HM-96T 96T
EUR 466

Human anti-golgi apparatus antibody(AGAA)ELISA Kit

QY-E02642 96T
EUR 361

Human NUMA1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit

SEP874Hu-10x96wellstestplate 10x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids.

for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit

SEP874Hu-1x48wellstestplate 1x48-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids.

for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit

SEP874Hu-1x96wellstestplate 1x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids.

for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)ELISA kit

SEP874Hu-5x96wellstestplate 5x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in Tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1)

  • Ask for price
  • Ask for price
  • Ask for price
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Mitotic Arrest Deficient 1 Like Protein 1 elisa. Alternative names of the recognized antigen: HsMAD1
  • MAD1
  • PIG9
  • TP53I9
  • TXBP181
  • Mitotic spindle assembly checkpoint protein MAD1
  • Mitotic checkpoint MAD1 protein homolog
  • Tax-binding pr
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mitotic Arrest Deficient 1 Like Protein 1 (MAD1L1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Mitotic- spindle organizing protein 2B, MZT2B ELISA KIT

ELI-13898h 96 Tests
EUR 824

Human Mitotic- spindle organizing protein 2A, MZT2A ELISA KIT

ELI-36851h 96 Tests
EUR 824

p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone KIP1/769 (Concentrate)

RA0078-C.1 0.1 ml
EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone KIP2/880 (Concentrate)

RA0081-C.1 0.1 ml
EUR 125

Human Mitotic Arrest Deficient 2 Like 1 (MAD2L1) ELISA Kit

abx388369-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Nuclear Receptor Interacting Protein 1 ELISA kit

E01N0045-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear Receptor Interacting Protein 1 ELISA kit

E01N0045-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear Receptor Interacting Protein 1 ELISA kit

E01N0045-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Receptor Interacting Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thymocyte nuclear protein 1(THYN1) ELISA kit

E01T0692-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thymocyte nuclear protein 1(THYN1) ELISA kit

E01T0692-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thymocyte nuclear protein 1(THYN1) ELISA kit

E01T0692-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thymocyte nuclear protein 1(THYN1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Thymocyte nuclear protein 1, THYN1 ELISA KIT

ELI-51973h 96 Tests
EUR 824

Human Thymocyte Nuclear Protein 1 (THYN1) ELISA Kit

abx383753-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NUMA1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1467102 1.0 ug DNA
EUR 154

NUMA1 Rabbit pAb

A0527-100ul 100 ul
EUR 308

NUMA1 Rabbit pAb

A0527-200ul 200 ul
EUR 459

NUMA1 Rabbit pAb

A0527-20ul 20 ul
EUR 183

NUMA1 Rabbit pAb

A0527-50ul 50 ul
EUR 223

NUMA1 Blocking Peptide

33R-1455 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUMA1 antibody, catalog no. 70R-8922

NUMA1 Blocking Peptide

DF4249-BP 1mg
EUR 195

NUMA1 Conjugated Antibody

C34869 100ul
EUR 397

NUMA1 cloning plasmid

CSB-CL016185HU1-10ug 10ug
EUR 1267
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3582
  • Sequence: atggctgccaccagcaaagaggtggcccgcttggagaccttggtgcgcaaggcaggtgagcagcaggaaacagcctcccgggagttagtcaaggagcctgcgagggcaggagacagacagcccgagtggctggaagagcaacagggacgccagttctgcagcacacaggcagcgc
  • Show more
Description: A cloning plasmid for the NUMA1 gene.

NUMA1 cloning plasmid

CSB-CL016185HU2-10ug 10ug
EUR 933
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2940
  • Sequence: atgacactccacgccacccggggggctgcactcctctcttgggtgaacagtctacacgtggctgaccctgtggaggctgtgctgcagctccaggactgcagcatcttcatcaagatcattgacagaatccatggcactgaagagggacagcaaatcttgaagcagccggtgtcag
  • Show more
Description: A cloning plasmid for the NUMA1 gene.

Anti-NUMA1 antibody

STJ24848 100 µl
EUR 277
Description: This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants.

Mouse Mitotic checkpoint protein BUB3, Bub3 ELISA KIT

ELI-11201m 96 Tests
EUR 865

Bovine Mitotic checkpoint protein BUB3, BUB3 ELISA KIT

ELI-50146b 96 Tests
EUR 928

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

p27Kip1 (Mitotic Inhibitor/Suppressor Protein); Clone DCS-72.F6 (Concentrate)

RA0079-C.1 0.1 ml
EUR 125

p57Kip2 (Mitotic Inhibitor/Suppressor Protein); Clone KP10 & KIP2/880 (Concentrate)

RA0477-C.1 0.1 ml
EUR 125

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human Mitotic Spindle Assembly Checkpoint Protein MAD1 (MAD1L1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

HeLa Nuclear Extract

EUR 338

Mouse Nuclear protein 1, Nupr1 ELISA KIT

ELI-36782m 96 Tests
EUR 865

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

NUMA1 ORF Vector (Human) (pORF)

ORF007297 1.0 ug DNA
EUR 95

NUMA1 ORF Vector (Human) (pORF)

ORF007298 1.0 ug DNA
EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

NUMA1 Protein Vector (Human) (pPB-C-His)

PV029185 500 ng
EUR 329

NUMA1 Protein Vector (Human) (pPB-N-His)

PV029186 500 ng
EUR 329

NUMA1 Protein Vector (Human) (pPM-C-HA)

PV029187 500 ng
EUR 329

NUMA1 Protein Vector (Human) (pPM-C-His)

PV029188 500 ng
EUR 329

Human NUMA1(Nuclear Mitotic Apparatus Protein 1) ELISA Kit