
Human brain gene expression atlas project

Human NXPH1(Neurexophilin 1) ELISA Kit

Human NXPH1(Neurexophilin 1) ELISA Kit

Human Neurexophilin 1 (NXPH1) ELISA Kit

RDR-NXPH1-Hu-48Tests 48 Tests
EUR 544

Human Neurexophilin 1 (NXPH1) ELISA Kit

RDR-NXPH1-Hu-96Tests 96 Tests
EUR 756

Human Neurexophilin- 1, NXPH1 ELISA KIT

ELI-38246h 96 Tests
EUR 824

Human Neurexophilin 1 (NXPH1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neurexophilin 1 (NXPH1) ELISA Kit

SEC672Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit

SEC672Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit

SEC672Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit

SEC672Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neurexophilin 1 (NXPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neurexophilin 1 (NXPH1) in Tissue homogenates and other biological fluids.

Human Neurexophilin 1 (NXPH1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurexophilin 1 elisa. Alternative names of the recognized antigen: NPH1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neurexophilin 1 (NXPH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Neurexophilin 1(NXPH1)ELISA Kit

QY-E01643 96T
EUR 361

NXPH1 Human, Neurexophilin 1 Human Recombinant Protein, Sf9

PROTP58417-1 Regular: 10ug
EUR 317
Description: NXPH1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 259 amino acids (22-271) and having a molecular mass of 29.7kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;NXPH1 is fused to 9 amino acid His-Tag at C-terminus and purified by proprietary chromatographic techniques.

Mouse Neurexophilin- 1, Nxph1 ELISA KIT

ELI-15133m 96 Tests
EUR 865

Bovine Neurexophilin- 1, NXPH1 ELISA KIT

ELI-46103b 96 Tests
EUR 928

Mouse Neurexophilin-1 (NXPH1) ELISA Kit

abx390007-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Neurexophilin-1 (NXPH1) ELISA Kit

abx391681-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Neurexophilin-1 (NXPH1) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Neurexophilin 1 (NXPH1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurexophilin-1 (NXPH1) Antibody

abx034416-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody

abx034416-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neurexophilin 1 (NXPH1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurexophilin 1 (NXPH1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody

abx235945-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Neurexophilin-1 (NXPH1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Neurexophilin 1 (NXPH1)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P58417
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Neurexophilin 1 expressed in: E.coli

ELISA kit for Human NXPH1 (Neurexophilin 1)

ELK3869 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurexophilin 1 (NXPH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurexophi
  • Show more
Description: A sandwich ELISA kit for detection of Neurexophilin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neurexophilin 1 (NXPH1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neurexophilin 1 (NXPH1) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nxph1 ELISA Kit| Rat Neurexophilin-1 ELISA Kit

EF019041 96 Tests
EUR 689

Nxph1 ELISA Kit| Mouse Neurexophilin-1 ELISA Kit

EF015646 96 Tests
EUR 689

NXPH1 ELISA Kit| Bovine Neurexophilin-1 ELISA Kit

EF011654 96 Tests
EUR 689

Neurexophilin-1 (NXPH1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin-1 (NXPH1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-NXPH1/Neurexophilin 1 Antibody

A12696 100ul
EUR 397
Description: Anti-NXPH1 Antibody

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1)

NXPH1 Neurexophilin 1 Human Recombinant Protein

PROTP58417 Regular: 20ug
EUR 317
Description: NXPH1 Human Recombinant produced in E. coli is. a single polypeptide chain containing 273 amino acids (22-271) and having a molecular mass of 31kDa. NXPH1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

C495-10ug 10ug
EUR 141
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

C495-1mg 1mg
EUR 1674
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

C495-500ug 500ug
EUR 1115
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Recombinant Human Neurexophilin-1/NXPH1 (C-6His)

C495-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.2.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Biotin.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with Cy3.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with FITC.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with HRP.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with PE.

Neurexophilin 1 (NXPH1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NXPH1 (Ala22~Gly271)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurexophilin 1 (NXPH1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Nxph1/ Rat Nxph1 ELISA Kit

ELI-22436r 96 Tests
EUR 886


EF001409 96 Tests
EUR 689

Anti-Neurexophilin-3 Antibody

A14597-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Neurexophilin-3 Antibody (NXPH3) detection.tested for WB in Human, Mouse, Rat.

NXPH1 ELISA Kit (Human) (OKCD00346)

OKCD00346 96 Wells
EUR 831
Description: Description of target: May be signaling molecules that resemble neuropeptides and that act by binding to alpha-neurexins and possibly other receptors.Curated ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.062 ng/mL

NXPH1 ELISA Kit (Human) (OKDD00444)

OKDD00444 96 Wells
EUR 975
Description: Description of target: This gene is a member of the neurexophilin family and encodes a secreted protein with a variable N-terminal domain, a highly conserved, N-glycosylated central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

Neurexophilin 1 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Neurexophilin- 4, NXPH4 ELISA KIT

ELI-22438h 96 Tests
EUR 824

Human Neurexophilin- 3, NXPH3 ELISA KIT

ELI-22577h 96 Tests
EUR 824

Human Neurexophilin- 2, NXPH2 ELISA KIT

ELI-44563h 96 Tests
EUR 824

Human Neurexophilin 4(NXPH4)ELISA Kit

QY-E01640 96T
EUR 361

Human Neurexophilin 3(NXPH3)ELISA Kit

QY-E01641 96T
EUR 361

Human Neurexophilin 2(NXPH2)ELISA Kit

QY-E01642 96T
EUR 361

Neurexophilin-1 Polyclonal Antibody

ES5710-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-1 Polyclonal Antibody

ES5710-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Neurexophilin-1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-1 Polyclonal Antibody

ABP54711-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

Neurexophilin-1 Polyclonal Antibody

ABP54711-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

Neurexophilin-1 Polyclonal Antibody

ABP54711-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-1 from Human, Mouse, Rat. This Neurexophilin-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-1 at AA rangle: 50-130

Anti-Neurexophilin-1 antibody

STJ94423 200 µl
EUR 197
Description: Rabbit polyclonal to Neurexophilin-1.

Mouse Neurexophilin- 2, Nxph2 ELISA KIT

ELI-22437m 96 Tests
EUR 865

Mouse Neurexophilin- 3, Nxph3 ELISA KIT

ELI-22578m 96 Tests
EUR 865

Bovine Neurexophilin- 2, NXPH2 ELISA KIT

ELI-36800b 96 Tests
EUR 928


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NXPH1 antibody

70R-50970 100 ul
EUR 244
Description: Purified Polyclonal NXPH1 antibody

NXPH1 antibody

70R-9330 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal NXPH1 antibody

NXPH1 Antibody

ABD4230 100 ug
EUR 438

NXPH1 Antibody

DF4230 200ul
EUR 304
Description: NXPH1 Antibody detects endogenous levels of total NXPH1.

NXPH1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

NXPH1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human Neurexophilin-2 (NXPH2)

  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 31.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Neurexophilin-2(NXPH2) expressed in Mammalian cell

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human NXPH1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NXPH1 Recombinant Protein (Human)

RP021991 100 ug Ask for price

Neurexophilin 4 antibody

70R-4049 50 ug
EUR 467
Description: Rabbit polyclonal Neurexophilin 4 antibody raised against the N terminal of NXPH4

Neurexophilin 3 antibody

70R-4470 50 ug
EUR 467
Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the N terminal of NXPH3

Neurexophilin 3 antibody

70R-4471 50 ug
EUR 467
Description: Rabbit polyclonal Neurexophilin 3 antibody raised against the middle region of NXPH3

anti-Neurexophilin 3

YF-PA17541 50 ug
EUR 363
Description: Mouse polyclonal to Neurexophilin 3

NXPH1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1471602 1.0 ug DNA
EUR 154

NXPH1 cloning plasmid

CSB-CL016227HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 816
  • Sequence: atgcaggctgcgtgctggtacgtgcttttcctcctgcagcccaccgtctacttggtcacatgtgccaatttaacgaacggtggaaagtcagaacttctgaaatcaggaagcagcaaatccacactaaagcacatatggacagaaagcagcaaagacttgtctatcagccgactcct
  • Show more
Description: A cloning plasmid for the NXPH1 gene.

anti- NXPH1 antibody

FNab05945 100µg
EUR 548.75
  • Immunogen: neurexophilin 1
  • Uniprot ID: P58417
  • Gene ID: 30010
  • Research Area: Neuroscience
Description: Antibody raised against NXPH1

NXPH1 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Nxph1 Blocking Peptide

33R-5184 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Nxph1 antibody, catalog no. 70R-9330

NXPH1 Blocking Peptide

DF4230-BP 1mg
EUR 195

Anti-NXPH1 antibody

PAab05945 100 ug
EUR 386

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

NXPH1 ORF Vector (Human) (pORF)

ORF007331 1.0 ug DNA
EUR 95

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Neurexophilin-3 Polyclonal Antibody

ES2927-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Neurexophilin-3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-3 Polyclonal Antibody

ES2927-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Neurexophilin-3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-4 Polyclonal Antibody

ES2928-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Neurexophilin-4 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin-4 Polyclonal Antibody

ES2928-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Neurexophilin-4 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neurexophilin 3 (NXPH3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody

abx026137-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody

abx026137-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody

abx029138-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody

abx029138-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neurexophilin-3 Polyclonal Antibody

ABP51928-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210

Neurexophilin-3 Polyclonal Antibody

ABP51928-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210

Neurexophilin-3 Polyclonal Antibody

ABP51928-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-3 from Human, Mouse, Rat. This Neurexophilin-3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neurexophilin-3 at AA range: 130-210

Neurexophilin-4 Polyclonal Antibody

ABP51929-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270

Neurexophilin-4 Polyclonal Antibody

ABP51929-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270

Neurexophilin-4 Polyclonal Antibody

ABP51929-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of Neurexophilin-4 from Human, Rat. This Neurexophilin-4 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Neurexophilin-4 at AA range: 190-270

Neurexophilin 3 (NXPH3) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin 3 (NXPH3) Antibody

abx331086-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Neurexophilin 4 (NXPH4) Antibody

abx332816-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Neurexophilin-2 (NXPH2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neurexophilin 4 Blocking Peptide

33R-6369 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH4 antibody, catalog no. 70R-4049

Neurexophilin 3 Blocking Peptide

33R-6733 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4471

Neurexophilin 3 Blocking Peptide

33R-7840 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NXPH3 antibody, catalog no. 70R-4470

Anti-Neurexophilin-3 antibody

STJ94424 200 µl
EUR 197
Description: Rabbit polyclonal to Neurexophilin-3.

Anti-Neurexophilin-4 antibody

STJ94425 200 µl
EUR 197
Description: Rabbit polyclonal to Neurexophilin-4.

Anti-Neurexophilin 3 (4C8)

YF-MA17693 100 ug
EUR 363
Description: Mouse monoclonal to Neurexophilin 3

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Rat NXPH1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NXPH1 protein (His tag)

80R-3672 100 ug
EUR 327
Description: Purified recombinant NXPH1 protein (His tag)

Mouse NXPH1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NXPH1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NXPH1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NXPH1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NXPH1. Recognizes NXPH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NXPH1 Recombinant Protein (Rat)

RP214922 100 ug Ask for price

NXPH1 Recombinant Protein (Mouse)

RP155579 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Nxph1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4768802 1.0 ug DNA
EUR 154

Nxph1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6870502 1.0 ug DNA
EUR 154

NXPH1 sgRNA CRISPR Lentivector set (Human)

K1471601 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit

EL3502-1 96 Well Plate
EUR 477

Human TGF-beta-1 AssayMax ELISA Kit

ET3102-1 96 Well Plate
EUR 477

Human PAI-1/tPA AssayMax ELISA Kit

EP1105-1 96 Well Plate
EUR 417

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Anti-NXPH3/Neurexophilin 3 Antibody

A14597 100ul
EUR 397
Description: Rabbit Polyclonal NXPH3/Neurexophilin 3 Antibody. Validated in WB and tested in Human.

Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

EK2802-1 96 Well Plate
EUR 477

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EI2200-1 96 Well Plate
EUR 477

Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit

EI2301-1 96 Well Plate
EUR 477

Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit

EP1100-1 96 Well Plate
EUR 417

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human Glutathione Transferase zeta 1 AssayMax ELISA Kit

EG2350-1 96 Well Plate
EUR 477

Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit

EG3928-1 96 Well Plate
EUR 477

Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit

EC5752-1 96 Well Plate
EUR 477

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

EA5001-1 96 Well Plate
EUR 417

Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

EA5101-1 96 Well Plate
EUR 417

Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit

EA5501-1 96 Well Plate
EUR 417

Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit

EE2702-1 96 Well Plate
EUR 477

Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit

EM5110-1 96 Well Plate
EUR 396

Polyclonal NXPH1 Antibody (aa77-126)

AMM06874G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NXPH1 (aa77-126). This antibody is tested and proven to work in the following applications:

Polyclonal NXPH1 Antibody (N-term)

AMM06875G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NXPH1 (N-term). This antibody is tested and proven to work in the following applications:

Nxph1 ORF Vector (Rat) (pORF)

ORF071642 1.0 ug DNA
EUR 506

Nxph1 ORF Vector (Mouse) (pORF)

ORF051861 1.0 ug DNA
EUR 506

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

NXPH1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1471603 1.0 ug DNA
EUR 154

NXPH1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1471604 1.0 ug DNA
EUR 154

Recombinant Human NXPH1 Protein, His, E.coli-10ug

QP12912-HIS-10ug 10ug
EUR 201

Recombinant Human NXPH1 Protein, His, E.coli-20ug

QP12912-HIS-20ug 20ug
EUR 201

Recombinant Human NXPH1 Protein, His, E.coli-2ug

QP12912-HIS-2ug 2ug
EUR 155

Human NXPH1(Neurexophilin 1) ELISA Kit