Human PENK(Proenkephalin) ELISA Kit

Human PENK(Proenkephalin) ELISA Kit

Human Proenkephalin (PENK) ELISA Kit
RDR-PENK-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Proenkephalin (PENK) ELISA Kit
RD-PENK-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Proenkephalin (PENK) ELISA Kit
RD-PENK-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Proenkephalin (PENK) ELISA Kit
DLR-PENK-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Proenkephalin (PENK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Proenkephalin (PENK) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Proenkephalin (PENK) ELISA Kit
DLR-PENK-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Proenkephalin (PENK) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Proenkephalin (PENK) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Proenkephalin (PENK) ELISA Kit
RDR-PENK-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Proenkephalin (PENK) ELISA Kit
RDR-PENK-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Proenkephalin (PENK) ELISA Kit
RD-PENK-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Proenkephalin (PENK) ELISA Kit
RD-PENK-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Proenkephalin (PENK)ELISA kit
201-12-2342	SunredBio	96 tests	EUR 440
This Proenkephalin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human proenkephalin (PENK) ELISA kit
CSB-EL017781HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human proenkephalin (PENK) in samples from serum, plasma, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human proenkephalin (PENK) ELISA kit
1-CSB-EL017781HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human proenkephalin (PENK) in samples from serum, plasma, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Proenkephalin (PENK) ELISA Kit
20-abx152830	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Proenkephalin (PENK) ELISA Kit
abx253776-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Proenkephalin(PENK)ELISA Kit
QY-E01908	Qayee Biotechnology	96T	EUR 361

Human Proenkephalin ELISA Kit (PENK)
RK02057	Abclonal	96 Tests	EUR 521

Human Proenkephalin (PENK) ELISA Kit
SED396Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proenkephalin (PENK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proenkephalin (PENK) in serum, plasma, tissue homogenates, cerebrospinal fluid and other biological fluids.

Human Proenkephalin (PENK) ELISA Kit
SED396Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proenkephalin (PENK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proenkephalin (PENK) in serum, plasma, tissue homogenates, cerebrospinal fluid and other biological fluids.

Human Proenkephalin (PENK) ELISA Kit
SED396Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proenkephalin (PENK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proenkephalin (PENK) in serum, plasma, tissue homogenates, cerebrospinal fluid and other biological fluids.

Human Proenkephalin (PENK) ELISA Kit
SED396Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Proenkephalin (PENK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Proenkephalin (PENK) in serum, plasma, tissue homogenates, cerebrospinal fluid and other biological fluids.

Human Proenkephalin (PENK) ELISA Kit
4-SED396Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Proenkephalin elisa. Alternative names of the recognized antigen: Preproenkephalin Proenkephalin-A Synenkephalin Met-enkephalin Met-enkephalin-Arg-Gly-Leu Leu-enkephalin Met-enkephalin-Arg-Phe
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Proenkephalin (PENK) in samples from serum, plasma, tissue homogenates, cerebrospinal fluid and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Proenkephalin (PENK) ELISA Kit
20-abx154579	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Proenkephalin(PENK)ELISA Kit
GA-E0931MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Proenkephalin(PENK)ELISA Kit
GA-E0931MS-96T	GenAsia Biotech	96T	EUR 534

Rat Proenkephalin(PENK)ELISA kit
QY-E10524	Qayee Biotechnology	96T	EUR 361

Mouse Proenkephalin (PENK) ELISA Kit
SED396Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Proenkephalin (PENK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Proenkephalin (PENK) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Proenkephalin (PENK) ELISA Kit
SED396Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Proenkephalin (PENK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Proenkephalin (PENK) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Proenkephalin (PENK) ELISA Kit
SED396Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Proenkephalin (PENK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Proenkephalin (PENK) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Proenkephalin (PENK) ELISA Kit
SED396Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Proenkephalin (PENK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Proenkephalin (PENK) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Proenkephalin (PENK) ELISA Kit
4-SED396Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Proenkephalin elisa. Alternative names of the recognized antigen: Preproenkephalin Proenkephalin-A Synenkephalin Met-enkephalin Met-enkephalin-Arg-Gly-Leu Leu-enkephalin Met-enkephalin-Arg-Phe
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Proenkephalin (PENK) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Proenkephalin ELISA Kit (PENK)
RK03111	Abclonal	96 Tests	EUR 521

Mouse Proenkephalin(PENK)ELISA kit
QY-E21228	Qayee Biotechnology	96T	EUR 400

Human PENK/ Proenkephalin-A ELISA Kit
E1905Hu	Sunlong	1 Kit	EUR 571

Human PENK(Proenkephalin-A) ELISA Kit
EH0819	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P01210 Alias: PENK/Proenkephalin-A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

ELISA kit for Human PENK (Proenkephalin)
ELK4086	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Proenkephalin (PENK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Proenkephalin Show more
Description: A sandwich ELISA kit for detection of Proenkephalin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Proenkephalin-A (PENK) ELISA Kit
abx571368-96tests	Abbexa	96 tests	EUR 652
Shipped within 5-12 working days.

ELISA kit for Human Proenkephalin (PENK)
KTE61251-48T	Abbkine	48T	EUR 332
Preproenkephalin has 267 amino acids, as does proopiomelanocortin. Both genes contain 2 introns. In both, all the repeated enkephalin or melanotropin sequences are encoded by a single large exon (exon 3). Preproenkephalin mRNA encodes 4 copies of met Show more
Description: Quantitative sandwich ELISA for measuring Human Proenkephalin (PENK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proenkephalin (PENK)
KTE61251-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Preproenkephalin has 267 amino acids, as does proopiomelanocortin. Both genes contain 2 introns. In both, all the repeated enkephalin or melanotropin sequences are encoded by a single large exon (exon 3). Preproenkephalin mRNA encodes 4 copies of met Show more
Description: Quantitative sandwich ELISA for measuring Human Proenkephalin (PENK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Proenkephalin (PENK)
KTE61251-96T	Abbkine	96T	EUR 539
Preproenkephalin has 267 amino acids, as does proopiomelanocortin. Both genes contain 2 introns. In both, all the repeated enkephalin or melanotropin sequences are encoded by a single large exon (exon 3). Preproenkephalin mRNA encodes 4 copies of met Show more
Description: Quantitative sandwich ELISA for measuring Human Proenkephalin (PENK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Proenkephalin (PENK) Antibody
20-abx004817	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Proenkephalin (PENK) Antibody
20-abx178094	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Proenkephalin (PENK) Antibody
20-abx178095	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Proenkephalin (PENK) Antibody
20-abx131497	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Proenkephalin (PENK) Antibody
20-abx142136	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Proenkephalin (PENK) Antibody
20-abx174165	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Proenkephalin (PENK)
4-RPD396Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P01210 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Proenkephalin expressed in: E.coli

Human Proenkephalin (PENK) CLIA Kit
20-abx494249	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Proenkephalin (PENK) Protein
20-abx650333	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse proenkephalin A (PENK) ELISA kit
CSB-EL017781MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse proenkephalin A (PENK) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse proenkephalin A (PENK) ELISA kit
1-CSB-EL017781MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse proenkephalin A (PENK) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Proenkephalin-A (PENK) ELISA Kit
abx256249-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Penk/ Proenkephalin-A ELISA Kit
E0747Ra	Sunlong	1 Kit	EUR 571

Mouse Penk/ Proenkephalin-A ELISA Kit
E1122Mo	Sunlong	1 Kit	EUR 571

Mouse Proenkephalin-A (PENK) ELISA Kit
abx576390-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Cow Proenkephalin-A (PENK) ELISA Kit
abx512457-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Mouse PENK (Proenkephalin)
ELK6073	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Proenkephalin (PENK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Proenkephalin Show more
Description: A sandwich ELISA kit for detection of Proenkephalin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Penk(Proenkephalin-A) ELISA Kit
ER0271	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P04094 Alias: Penk/Proenkephalin-A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

ELISA kit for Bovine Proenkephalin (PENK)
KTE10208-48T	Abbkine	48T	EUR 354
Preproenkephalin has 267 amino acids, as does proopiomelanocortin. Both genes contain 2 introns. In both, all the repeated enkephalin or melanotropin sequences are encoded by a single large exon (exon 3). Preproenkephalin mRNA encodes 4 copies of met Show more
Description: Quantitative sandwich ELISA for measuring Bovine Proenkephalin (PENK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Proenkephalin (PENK)
KTE10208-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Preproenkephalin has 267 amino acids, as does proopiomelanocortin. Both genes contain 2 introns. In both, all the repeated enkephalin or melanotropin sequences are encoded by a single large exon (exon 3). Preproenkephalin mRNA encodes 4 copies of met Show more
Description: Quantitative sandwich ELISA for measuring Bovine Proenkephalin (PENK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Proenkephalin (PENK)
KTE10208-96T	Abbkine	96T	EUR 572
Preproenkephalin has 267 amino acids, as does proopiomelanocortin. Both genes contain 2 introns. In both, all the repeated enkephalin or melanotropin sequences are encoded by a single large exon (exon 3). Preproenkephalin mRNA encodes 4 copies of met Show more
Description: Quantitative sandwich ELISA for measuring Bovine Proenkephalin (PENK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Proenkephalin (PENK)
KTE70772-48T	Abbkine	48T	EUR 332
Preproenkephalin has 267 amino acids, as does proopiomelanocortin. Both genes contain 2 introns. In both, all the repeated enkephalin or melanotropin sequences are encoded by a single large exon (exon 3). Preproenkephalin mRNA encodes 4 copies of met Show more
Description: Quantitative sandwich ELISA for measuring Mouse Proenkephalin (PENK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Proenkephalin (PENK)
KTE70772-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Preproenkephalin has 267 amino acids, as does proopiomelanocortin. Both genes contain 2 introns. In both, all the repeated enkephalin or melanotropin sequences are encoded by a single large exon (exon 3). Preproenkephalin mRNA encodes 4 copies of met Show more
Description: Quantitative sandwich ELISA for measuring Mouse Proenkephalin (PENK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Proenkephalin (PENK)
KTE70772-96T	Abbkine	96T	EUR 539
Preproenkephalin has 267 amino acids, as does proopiomelanocortin. Both genes contain 2 introns. In both, all the repeated enkephalin or melanotropin sequences are encoded by a single large exon (exon 3). Preproenkephalin mRNA encodes 4 copies of met Show more
Description: Quantitative sandwich ELISA for measuring Mouse Proenkephalin (PENK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Proenkephalin (PENK) CLIA Kit
20-abx494250	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Proenkephalin (PENK) Protein
20-abx654799	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Proenkephalin (PENK) Protein
20-abx654800	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Proenkephalin (PENK) Polyclonal Antibody (Human)
4-PAD396Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PENK (Glu25~ Phe267) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK)

Penk ELISA Kit\| Rat Proenkephalin-A ELISA Kit
EF016934	Lifescience Market	96 Tests	EUR 689

Proenkephalin (PENK) Polyclonal Antibody (Human), APC
4-PAD396Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PENK (Glu25~ Phe267) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with APC.

Proenkephalin (PENK) Polyclonal Antibody (Human), Biotinylated
4-PAD396Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PENK (Glu25~ Phe267) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with Biotin.

Proenkephalin (PENK) Polyclonal Antibody (Human), Cy3
4-PAD396Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PENK (Glu25~ Phe267) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with Cy3.

Proenkephalin (PENK) Polyclonal Antibody (Human), FITC
4-PAD396Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PENK (Glu25~ Phe267) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with FITC.

Proenkephalin (PENK) Polyclonal Antibody (Human), HRP
4-PAD396Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PENK (Glu25~ Phe267) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with HRP.

Proenkephalin (PENK) Polyclonal Antibody (Human), PE
4-PAD396Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PENK (Glu25~ Phe267) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with PE.

Proenkephalin (PENK) Polyclonal Antibody (Human), APC-Cy7
4-PAD396Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PENK (Glu25~ Phe267) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Proenkephalin (PENK). This antibody is labeled with APC-Cy7.

Human PENK ELISA Kit
ELA-E0279h	Lifescience Market	96 Tests	EUR 824

PENK ELISA KIT\|Human
EF000539	Lifescience Market	96 Tests	EUR 689

PENK ELISA Kit (Human) (OKAN06551)
OKAN06551	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

PENK ELISA Kit (Human) (OKCD08471)
OKCD08471	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Met- and Leu-enkephalins compete with and mimic the effects of opiate drugs. They play a role in a number of physiologic functions, including pain perception and responses to stress. PENK (114-133) and PENK (237-258) increase glutamate release in the stri;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

PENK ELISA Kit (Human) (OKEH04183)
OKEH04183	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31 pg/mL

Human Proenkephalin A ELISA kit
E01P0943-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proenkephalin A ELISA kit
E01P0943-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proenkephalin A ELISA kit
E01P0943-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Enkephalin (PENK) ELISA Kit
20-abx156933	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Proenkephalin B(PDYN) ELISA kit
E01P0838-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proenkephalin B(PDYN) ELISA kit
E01P0838-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proenkephalin B(PDYN) ELISA kit
E01P0838-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Proenkephalin-B (PDYN) ELISA Kit
abx250393-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Proenkephalin-B
EK2564	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Proenkephalin-B in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PDYN/ Proenkephalin-B ELISA Kit
E1902Hu	Sunlong	1 Kit	EUR 605

Human PDYN(Proenkephalin-B) ELISA Kit
EH1143	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P01213 Alias: PDYN/Proenkephalin-B/Beta-neoendorphin-dynorphin/Preprodynorphin
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Proenkephalin- B, PDYN ELISA KIT
ELI-03281h	Lifescience Market	96 Tests	EUR 824

PENK ELISA Kit (Mouse) (OKAN06284)
OKAN06284	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29 pg/mL

PENK ELISA Kit (Mouse) (OKCD02795)
OKCD02795	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Met- and Leu-enkephalins compete with and mimic the effects of opiate drugs. They play a role in a number of physiologic functions, including pain perception and responses to stress. PENK(114-133) and PENK(238-259) increase glutamate release in the striatum. PENK(114-133) decreases GABA concentration in the striatum. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29 pg/mL

PENK ELISA Kit (Mouse) (OKCA02184)
OKCA02184	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Met- and Leu-enkephalins compete with and mimic the effects of opiate drugs. They play a role in a number of physiologic functions, including pain perception and responses to stress. PENK(114-133) and PENK(238-259) increase glutamate release in the striatum. PENK(114-133) decreases GABA concentration in the striatum. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.12 pg/mL

PENK ELISA Kit (Rat) (OKEH03078)
OKEH03078	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Met- and Leu-enkephalins compete with and mimic the effects of opiate drugs. They play a role in a number of physiologic functions, including pain perception and responses to stress. PENK(114-133) and PENK(239-260) increase glutamate release in the striatum. PENK(114-133) decreases GABA concentration in the striatum.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Rabbit Proenkephalin A ELISA kit
E04P0943-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Proenkephalin A ELISA kit
E04P0943-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Proenkephalin A ELISA kit
E04P0943-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin A ELISA kit
E02P0943-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin A ELISA kit
E02P0943-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin A ELISA kit
E02P0943-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Proenkephalin A ELISA kit
E03P0943-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Proenkephalin A ELISA kit
E03P0943-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Proenkephalin A ELISA kit
E03P0943-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Proenkephalin A ELISA kit
E06P0943-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Proenkephalin A ELISA kit
E06P0943-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Proenkephalin A ELISA kit
E06P0943-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Proenkephalin A ELISA kit
E08P0943-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Proenkephalin A ELISA kit
E08P0943-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Proenkephalin A ELISA kit
E08P0943-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Proenkephalin A ELISA kit
E07P0943-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Proenkephalin A ELISA kit
E07P0943-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Proenkephalin A ELISA kit
E07P0943-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Proenkephalin A ELISA kit
E09P0943-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Proenkephalin A ELISA kit
E09P0943-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Proenkephalin A ELISA kit
E09P0943-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

PENK antibody
38808-100ul	SAB	100ul	EUR 252

PENK Antibody
1-CSB-PA994912	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against PENK. Recognizes PENK from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

PENK antibody
70R-6226	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PENK antibody raised against the middle region of PENK

Enkephalin (PENK) CLIA Kit
20-abx490372	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Proenkephalin siRNA
20-abx903939	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Proenkephalin Antibody
abx431505-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Proenkephalin Antibody
abx433184-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Proenkephalin siRNA
20-abx928243	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Proenkephalin siRNA
20-abx928244	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Rat Proenkephalin-B(PDYN) ELISA kit
CSB-EL017750RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Proenkephalin-B (PDYN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Proenkephalin-B(PDYN) ELISA kit
1-CSB-EL017750RA	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Proenkephalin-B(PDYN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit Proenkephalin B(PDYN) ELISA kit
E04P0838-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Proenkephalin B(PDYN) ELISA kit
E04P0838-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Proenkephalin B(PDYN) ELISA kit
E04P0838-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Proenkephalin A ELISA kit
E05P0943-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Proenkephalin A ELISA kit
E05P0943-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Proenkephalin A ELISA kit
E05P0943-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin A in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin B(PDYN) ELISA kit
E02P0838-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin B(PDYN) ELISA kit
E02P0838-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin B(PDYN) ELISA kit
E02P0838-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Proenkephalin B(PDYN) ELISA kit
E03P0838-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Proenkephalin B(PDYN) ELISA kit
E03P0838-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Proenkephalin B(PDYN) ELISA kit
E03P0838-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Proenkephalin B(PDYN) ELISA kit
E06P0838-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Proenkephalin B(PDYN) ELISA kit
E06P0838-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Proenkephalin B(PDYN) ELISA kit
E06P0838-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Proenkephalin-B (PDYN) ELISA Kit
abx256392-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Dog Proenkephalin B(PDYN) ELISA kit
E08P0838-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Proenkephalin B(PDYN) ELISA kit
E08P0838-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Proenkephalin B(PDYN) ELISA kit
E08P0838-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Proenkephalin-B
EK2565	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Proenkephalin-B in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Pdyn/ Proenkephalin-B ELISA Kit
E0745Ra	Sunlong	1 Kit	EUR 646

Pig Proenkephalin B(PDYN) ELISA kit
E07P0838-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Proenkephalin B(PDYN) ELISA kit
E07P0838-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Proenkephalin B(PDYN) ELISA kit
E07P0838-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Proenkephalin B(PDYN) ELISA kit
E09P0838-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Proenkephalin B(PDYN) ELISA kit
E09P0838-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Proenkephalin B(PDYN) ELISA kit
E09P0838-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Proenkephalin- B, PDYN ELISA KIT
ELI-03279p	Lifescience Market	96 Tests	EUR 928

Mouse Proenkephalin- B, Pdyn ELISA KIT
ELI-03280m	Lifescience Market	96 Tests	EUR 865

Bovine Proenkephalin- B, PDYN ELISA KIT
ELI-03282b	Lifescience Market	96 Tests	EUR 928

Cow Proenkephalin-B (PDYN) ELISA Kit
abx514688-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Proenkephalin-B (PDYN) ELISA Kit
abx514690-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Pig Proenkephalin-B (PDYN) ELISA Kit
abx514691-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Pdyn(Proenkephalin-B) ELISA Kit
EM7991	FN Test	96T	EUR 567.6
Detection range: 31.25-2000 pg/ml Uniprot ID: O35417
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Rat Pdyn(Proenkephalin-B) ELISA Kit
ER0414	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P06300 Alias: Pdyn/PDYN/Proenkephalin-B/Beta-neoendorphin-dynorphin/Preprodynorphin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.9pg/ml

Pdyn ELISA Kit\| Rat Proenkephalin-B ELISA Kit
EF017261	Lifescience Market	96 Tests	EUR 689

Pdyn ELISA Kit\| Mouse Proenkephalin-B ELISA Kit
EF015939	Lifescience Market	96 Tests	EUR 689

PDYN ELISA Kit\| Bovine Proenkephalin-B ELISA Kit
EF011786	Lifescience Market	96 Tests	EUR 689

Human PENK shRNA Plasmid
20-abx953457	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PENK Recombinant Protein (Human)
RP023086	ABM	100 ug	Ask for price

Guinea pig Proenkephalin B(PDYN) ELISA kit
E05P0838-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Proenkephalin B(PDYN) ELISA kit
E05P0838-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Proenkephalin B(PDYN) ELISA kit
E05P0838-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Proenkephalin B(PDYN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Proenkephalin-B (PDYN)
KTE100489-48T	Abbkine	48T	EUR 332
Prodynorphin is a opioid polypeptide hormone involved with chemical signal transduction and cell communication. The gene for prodynorphin is expressed in the endometrium and the striatum, and its gene map locus is 20pter-p12. Prodynorphin is a basic Show more
Description: Quantitative sandwich ELISA for measuring Rat Proenkephalin-B (PDYN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Proenkephalin-B (PDYN)
KTE100489-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Prodynorphin is a opioid polypeptide hormone involved with chemical signal transduction and cell communication. The gene for prodynorphin is expressed in the endometrium and the striatum, and its gene map locus is 20pter-p12. Prodynorphin is a basic Show more
Description: Quantitative sandwich ELISA for measuring Rat Proenkephalin-B (PDYN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Proenkephalin-B (PDYN)
KTE100489-96T	Abbkine	96T	EUR 539
Prodynorphin is a opioid polypeptide hormone involved with chemical signal transduction and cell communication. The gene for prodynorphin is expressed in the endometrium and the striatum, and its gene map locus is 20pter-p12. Prodynorphin is a basic Show more
Description: Quantitative sandwich ELISA for measuring Rat Proenkephalin-B (PDYN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PENK Blocking Peptide
33R-1846	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PENK antibody, catalog no. 70R-6226

PENK Polyclonal Antibody
46755-100ul	SAB	100ul	EUR 252

PENK Polyclonal Antibody
46755-50ul	SAB	50ul	EUR 187

Enkephalin (PENK) Antibody
20-abx130512	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

PENK Conjugated Antibody
C38808	SAB	100ul	EUR 397

Enkephalin (PENK) Antibody
20-abx324981	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

PENK cloning plasmid
CSB-CL017781HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 804 Sequence: atggcgcggttcctgacactttgcacttggctgctgttgctcggccccgggctcctggcgaccgtgcgggccgaatgcagccaggattgcgcgacgtgcagctaccgcctagtgcgcccggccgacatcaacttcctggcttgcgtaatggaatgtgaaggtaaactgccttctct Show more
Description: A cloning plasmid for the PENK gene.

PENK Rabbit pAb
A6302-100ul	Abclonal	100 ul	EUR 308

PENK Rabbit pAb
A6302-200ul	Abclonal	200 ul	EUR 459

PENK Rabbit pAb
A6302-20ul	Abclonal	20 ul	EUR 183

PENK Rabbit pAb
A6302-50ul	Abclonal	50 ul	EUR 223

PENK Polyclonal Antibody
ABP57554-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic peptide from human protein at AA range: 51-100 Applications tips:
Description: A polyclonal antibody for detection of PENK from Human. This PENK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 51-100

PENK Polyclonal Antibody
ABP57554-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic peptide from human protein at AA range: 51-100 Applications tips:
Description: A polyclonal antibody for detection of PENK from Human. This PENK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 51-100

PENK Polyclonal Antibody
ABP57554-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic peptide from human protein at AA range: 51-100 Applications tips:
Description: A polyclonal antibody for detection of PENK from Human. This PENK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 51-100

PENK Polyclonal Antibody
ES8547-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PENK from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PENK Polyclonal Antibody
ES8547-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PENK from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-PENK antibody
STJ28224	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities.

Anti-PENK antibody
STJ98660	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to PENK.

Anti-PENK (9E7)
YF-MA20202	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PENK

Anti-Proenkephalin antibody
STJ71379	St John's Laboratory	100 µg	EUR 359

PENK ORF Vector (Human) (pORF)
ORF007696	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Mouse PENK shRNA Plasmid
20-abx971996	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat PENK shRNA Plasmid
20-abx985371	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Enkephalin (PENK) Protein (OVA)
20-abx651205	Abbexa	EUR 258.00 EUR 189.00 EUR 537.00 EUR 272.00 EUR 217.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human PENK(Proenkephalin) ELISA Kit

Powered By WordPress | Zion Blog