
Human brain gene expression atlas project

Human PTMa(Prothymosin Alpha) ELISA Kit

Human PTMa(Prothymosin Alpha) ELISA Kit

Human Prothymosin Alpha (PTMa) ELISA Kit

RD-PTMa-Hu-48Tests 48 Tests
EUR 521

Human Prothymosin Alpha (PTMa) ELISA Kit

RD-PTMa-Hu-96Tests 96 Tests
EUR 723

Human Prothymosin alpha (PTMA)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

Human Prothymosin alpha (PTMA)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

Human Prothymosin Alpha (PTMa)ELISA kit

201-12-2264 96 tests
EUR 440
  • This Prothymosin Alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Prothymosin alpha (PTMa) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Prothymosin alpha (PTMA) ELISA Kit

abx251157-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human PTMA/ Prothymosin alpha ELISA Kit

E2090Hu 1 Kit
EUR 571

Human PTMA(Prothymosin alpha) ELISA Kit

EH1845 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P06454
  • Alias: PTMA/Prothymosin alpha/TMSA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Prothymosin alpha, PTMA ELISA KIT

ELI-05264h 96 Tests
EUR 824

Human Prothymosin alpha (PTMA) ELISA Kit

abx517923-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Prothymosin Alpha(PTMa)ELISA Kit

QY-E01901 96T
EUR 361

Human Prothymosin Alpha (PTMa) ELISA Kit

SED221Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

SED221Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

SED221Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

SED221Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prothymosin Alpha elisa. Alternative names of the recognized antigen: TMSA
  • PTM-A
  • Pro-Thymosin A
  • Gene Sequence 28
  • Thymosin alpha-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prothymosin Alpha (PTMa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Prothymosin alpha (Ptma)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Prothymosin alpha(Ptma) expressed in Yeast

Prothymosin Alpha (PTMA) Antibody

abx026432-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

abx026432-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMa) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prothymosin Alpha (PTMa) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Prothymosin Alpha (PTMA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody

abx236808-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Prothymosin Alpha (PTMA) Antibody

abx431948-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Prothymosin Alpha (PTMA) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Recombinant Prothymosin Alpha (PTMa)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P06454
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.1kDa
  • Isoelectric Point: 3.7
Description: Recombinant Human Prothymosin Alpha expressed in: E.coli

Recombinant Prothymosin Alpha (PTMa)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.2kDa
  • Isoelectric Point: 3.7
Description: Recombinant Rat Recombinant Prothymosin Alpha (PTMa) expressed in: E.coli

Mouse Ptma/ Prothymosin alpha ELISA Kit

E1227Mo 1 Kit
EUR 571

Bovine Prothymosin alpha, PTMA ELISA KIT

ELI-05262b 96 Tests
EUR 928

Mouse Prothymosin alpha, Ptma ELISA KIT

ELI-05263m 96 Tests
EUR 865

Cow Prothymosin alpha (PTMA) ELISA Kit

abx517922-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Prothymosin alpha (PTMA) ELISA Kit

abx517924-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Prothymosin alpha (PTMA) ELISA Kit

abx517925-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Prothymosin Alpha(PTMa)ELISA kit

GA-E0811MS-48T 48T
EUR 336

Mouse Prothymosin Alpha(PTMa)ELISA kit

GA-E0811MS-96T 96T
EUR 534

Rat Prothymosin Alpha(PTMa)ELISA kit

QY-E10505 96T
EUR 361

Mouse Prothymosin Alpha(PTMa)ELISA kit

QY-E21293 96T
EUR 361

Human Prothymosin Alpha (PTMA) Protein

abx060044-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

Human Prothymosin Alpha (PTMa) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Prothymosin alpha (PTMa) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human PTMa (Prothymosin Alpha)

ELK3885 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prothymosin Alpha (PTM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prothymos
  • Show more
Description: A sandwich ELISA kit for detection of Prothymosin Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Prothymosin, alpha (PTMA)

KTE61059-48T 48T
EUR 354
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prothymosin, alpha (PTMA)

KTE61059-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prothymosin, alpha (PTMA)

KTE61059-96T 96T
EUR 572
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Prothymosin, alpha (PTMA)

KTE20099-48T 48T
EUR 354
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Prothymosin, alpha (PTMA)

KTE20099-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Prothymosin, alpha (PTMA)

KTE20099-96T 96T
EUR 572
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Prothymosin Alpha (PTMa) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa)

PTMA Prothymosin Alpha Human Recombinant Protein

PROTP06454-1 Regular: 10ug
EUR 317
Description: PTMA Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 133 amino acids (1-110) and having a molecular mass of 14.5 kDa.;PTMA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Biotin.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Cy3.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with FITC.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with HRP.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with PE.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC-Cy7.

ELISA kit for Human Prothymosin alpha

EK3812 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Prothymosin alpha in samples from serum, plasma, tissue homogenates and other biological fluids.

Prothymosin, alpha Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Ptma/ Rat Ptma ELISA Kit

ELI-05265r 96 Tests
EUR 657

Prothymosin alpha Polyclonal Antibody

42262-100ul 100ul
EUR 333

Prothymosin alpha Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prothymosin alpha Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prothymosin alpha Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Prothymosin alpha Blocking Peptide

  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

anti- Prothymosin alpha antibody

FNab06808 100µg
EUR 585
  • Immunogen: prothymosin, alpha
  • Uniprot ID: P06454
  • Research Area: Cancer, Metabolism
Description: Antibody raised against Prothymosin alpha

Anti-Prothymosin alpha antibody

PAab06808 100 ug
EUR 412


ELA-E1609h 96 Tests
EUR 824


EF005969 96 Tests
EUR 689

Prothymosin alpha Polyclonal Conjugated Antibody

C42262 100ul
EUR 397

PTMA ELISA Kit (Human) (OKCD08419)

OKCD08419 96 Wells
EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

PTMA ELISA Kit (Human) (OKEH01154)

OKEH01154 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.039 ng/mL


E541-447 100ug
EUR 343

PTMA ELISA Kit (Rat) (OKEH06132)

OKEH06132 96 Wells
EUR 662
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL

PTMA ELISA Kit (Mouse) (OKEH04264)

OKEH04264 96 Wells
EUR 662
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.164 ng/mL

PTMA antibody

70R-19633 50 ul
EUR 435
Description: Rabbit polyclonal PTMA antibody

PTMA Antibody

37277-100ul 100ul
EUR 252

PTMA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PTMA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PTMA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PTMA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PTMA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMS Prothymosin Human Recombinant Protein

PROTP20962 Regular: 10ug
EUR 317
Description: PTMS Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 125 amino acids (1-102aa) and having a molecular mass of 13.9kDa.

Human PTMA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTMA Recombinant Protein (Human)

RP025144 100 ug Ask for price

PTMA Recombinant Protein (Human)

RP025147 100 ug Ask for price

Human TNF-alpha ELISA Kit, 96 tests, Quantitative

100-215-TNH 1 kit
EUR 482

PTMA Conjugated Antibody

C37277 100ul
EUR 397

PTMA cloning plasmid

CSB-CL019000HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
  • Show more
Description: A cloning plasmid for the PTMA gene.

PTMA cloning plasmid

CSB-CL019000HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
  • Show more
Description: A cloning plasmid for the PTMA gene.

Monoclonal PTMA Antibody

AMM01760G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human PTMA. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC, IP

PTMA Polyclonal Antibody

A52464 100 µg
EUR 570.55
Description: The best epigenetics products

PTMA Rabbit pAb

A1956-100ul 100 ul
EUR 308

PTMA Rabbit pAb

A1956-200ul 200 ul
EUR 459

PTMA Rabbit pAb

A1956-20ul 20 ul
EUR 183

PTMA Rabbit pAb

A1956-50ul 50 ul
EUR 223

PTMA Polyclonal Antibody

ABP60026-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PTMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein

PTMA Polyclonal Antibody

ABP60026-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein

PTMA Polyclonal Antibody

ABP60026-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein

PTMA Polyclonal Antibody

ES11817-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTMA Polyclonal Antibody

ES11817-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-PTMA antibody

STJ11100717 100 µl
EUR 277

Anti-PTMA antibody

STJ192975 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTMA

Anti-PTMA antibody

STJ71788 100 µg
EUR 359

PTMA ORF Vector (Human) (pORF)

ORF008382 1.0 ug DNA
EUR 95

PTMA ORF Vector (Human) (pORF)

ORF008383 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Alpha Fetoprotein (AFP) ELISA Kit, 96 tests, Quantitative

500 1 kit
EUR 469

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse alpha 2-Macroglobulin (A2M) ELISA kit

600-720-A2M 1 Kit
EUR 773

Human Anti-Alpha Fodrin IgG ELISA kit, 96 tests, Quantitative

3300-160-AFG 1 kit
EUR 590

Human hypoxia-inducible transcription factor 1 alpha (HIF-1 alpha) ELISA Kit, 96 tests, Quantitative

100-530-HIF 1 Kit
EUR 712

PTMA Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTMA Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTMA Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PTMA protein (His tag)

80R-3024 50 ug
EUR 413
Description: Purified recombinant PTMA protein (His tag)

Mouse PTMA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PTMA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTMA Recombinant Protein (Mouse)

RP165578 100 ug Ask for price

PTMA Recombinant Protein (Rat)

RP222875 100 ug Ask for price

PTMA sgRNA CRISPR Lentivector set (Human)

K1752701 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Recombinant (E.Coli) Human p38 alpha/SAPK2 alpha

RP-675 1 ug
EUR 286

Mouse TNF-alpha ELISA Kit, 96 tests, Quantitative

100-210-TNF 1 kit
EUR 482

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human 17 alpha Hydroxyprogesterone (17-OHP/17OHP) ELISA Kit, 96 tests, Quantitative

1870 1 kit
EUR 529

Human Zeta (z) Globin (alpha thalassemia ) ELISA Kit, 96 tests, Semi-Quantitative

1970 1 kit
EUR 651

Human Fodrin-alpha (spectrin-alpha) control/blocking peptide

FOD11-P 100 ug
EUR 164

Rabbit Anti-Human Fodrin-alpha (spectrin-alpha) antiserum

FOD11-S 100 ul
EUR 457

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

Recombinant Human Alpha-Synuclein

RP-847 20 ug
EUR 164

Chicken Interferon alpha (IFN-?) ELISA Kit, 96 tests, Quantitative

10680 1 Kit
EUR 773

Monkey Interferon-alpha (IFN-?) ELISA Kit, 96 tests, Quantitative

9745 1 Kit
EUR 773

Pig Alpha Fetoprotein (?FP) ELISA Kit, 96 tests, Quantitative

9930 1 Kit
EUR 773

Pig Interferon alpha (IFN-?) ELISA Kit, 96 tests, Quantitative

9945 1 Kit
EUR 773

Mouse IL-1 alpha ELISA Kit, 96 tests, Quantitative

MIL-01A-145 1 kit
EUR 482

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PTMA sgRNA CRISPR Lentivector (Human) (Target 1)

K1752702 1.0 ug DNA
EUR 154

PTMA sgRNA CRISPR Lentivector (Human) (Target 2)

K1752703 1.0 ug DNA
EUR 154

PTMA sgRNA CRISPR Lentivector (Human) (Target 3)

K1752704 1.0 ug DNA
EUR 154

PTMA Protein Vector (Human) (pPB-C-His)

PV033525 500 ng
EUR 329

PTMA Protein Vector (Human) (pPB-N-His)

PV033526 500 ng
EUR 329

PTMA Protein Vector (Human) (pPM-C-HA)

PV033527 500 ng
EUR 329

PTMA Protein Vector (Human) (pPM-C-His)

PV033528 500 ng
EUR 329

PTMA Protein Vector (Human) (pPB-C-His)

PV033529 500 ng
EUR 329

PTMA Protein Vector (Human) (pPB-N-His)

PV033530 500 ng
EUR 329

PTMA Protein Vector (Human) (pPM-C-HA)

PV033531 500 ng
EUR 329

PTMA Protein Vector (Human) (pPM-C-His)

PV033532 500 ng
EUR 329

Recombinant Human PTMA Protein, His, E.coli-10ug

QP13206-10ug 10ug
EUR 201

Recombinant Human PTMA Protein, His, E.coli-1mg

QP13206-1mg 1mg
EUR 5251

Recombinant Human PTMA Protein, His, E.coli-2ug

QP13206-2ug 2ug
EUR 155

Polyclonal PTMA Antibody (N-term)

APR03615G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTMA (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal PTMA Antibody (C-Term)

APG00574G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal PTMA Antibody (C-Terminus)

APG01175G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Terminus). This antibody is tested and proven to work in the following applications:

PTMA Polyclonal Antibody, Biotin Conjugated

A52461 100 µg
EUR 570.55
Description: Ask the seller for details

PTMA Polyclonal Antibody, FITC Conjugated

A52462 100 µg
EUR 570.55
Description: The best epigenetics products

PTMA Polyclonal Antibody, HRP Conjugated

A52463 100 µg
EUR 570.55
Description: kits suitable for this type of research

Ptma ORF Vector (Rat) (pORF)

ORF074293 1.0 ug DNA
EUR 506

Ptma ORF Vector (Mouse) (pORF)

ORF055194 1.0 ug DNA
EUR 506

Rabbit Anti-Human Glutathione Transferase alpha (GST-alpha) antiserum

GSTA12-S 100 ul
EUR 457

human Topoisomerase II alpha (TOP2 alpha) Control/blocking peptide

TOP2A11-P 100 ug
EUR 164

Human IL-2 receptor alpha, soluble (IL2RsA/CD25) ELISA Kit, 96 tests, quantitative

210-340-I2R 1 Kit
EUR 773

Horse Interleukin 1 alpha (IL1a) ELISA Kit, 96 tests, Quantitative

10515 1 Kit
EUR 773

Rat TNF-alpha ELISA Kit, High Sensitivity, 96 tests, Quantitative

100-205-TNR 1 kit
EUR 482

Rat alpha 2-Macroglobulin (A2M) ELISA kit 96 tests, Quantitative

610-420-A2M 1 Kit
EUR 773

Guinea pig Interferon-alpha (IFN-?) ELISA Kit, 96 tests, Quantitative

9880 1 Kit
EUR 773

Mouse Alpha defensin 1 (DEFa1) ELISA Kit, 96 tests, Quantitative

9205 1 Kit
EUR 895

Mouse Estrogen Receptor Alpha (ER?) ELISA Kit, 96 tests, Quantitative

9265 1 Kit
EUR 773

Human Alpha-Thrombin (human plasma), purified

TBNA16-N-100 100 ug
EUR 164

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Rabbit Anti-Human Estrogen receptor alpha (ER-alpha) peptide IgG

ERA12-A 100 ug
EUR 482

Rabbit Anti-Human Fodrin-alpha (spectrin-alpha) IgG, aff pure

FOD11-A 100 ug
EUR 482

Recombinant purified, human Interleukin-1 alpha (IL-1 alpha), active

IL1A15-R-10 10 ug
EUR 347

Human Recombinant Transforming Growth Factor-alpha (TGF-alpha), biologically active

TGFA15-R-100 100 ug
EUR 529

Human Recombinant Transforming Growth Factor-alpha (TGF-alpha), biologically active

TGFA15-R-1000 1000 ug
EUR 3521

Human Recombinant Transforming Growth Factor-alpha (TGF-alpha), biologically active

TGFA15-R-20 20 ug
EUR 225

Alpha 1-Antitrypsin, Human Plasma

A1AT15-N 1 mg
EUR 164

Alpha 1-Antichymotrypsin , Human Plasma

A1CT15-N-100 100 ug
EUR 164

Alpha 2-Antiplasmin, Human Plasma

A2AP15-100 100 ug
EUR 164

Recombinant (E.Coli) Human Thyrostimulin Alpha

RP-595 10 ug
EUR 286

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Human PTMa(Prothymosin Alpha) ELISA Kit