Human PTMa(Prothymosin Alpha) ELISA Kit
Human Prothymosin Alpha (PTMa) ELISA Kit |
RDR-PTMa-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Prothymosin Alpha (PTMa) ELISA Kit |
RDR-PTMa-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Prothymosin alpha (PTMA) |
1-CSB-YP019000HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 14.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast |
Human Prothymosin alpha (PTMA) |
1-CSB-YP019000HUb0 |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 14.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast |
Human Prothymosin alpha (PTMA) ELISA Kit |
abx517923-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human PTMA/ Prothymosin alpha ELISA Kit |
E2090Hu |
Sunlong |
1 Kit |
EUR 571 |
Human PTMA(Prothymosin alpha) ELISA Kit |
EH1845 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P06454
- Alias: PTMA/Prothymosin alpha/TMSA
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Prothymosin alpha (PTMa) ELISA Kit |
20-abx152865 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Prothymosin alpha (PTMA) ELISA Kit |
abx251157-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Prothymosin Alpha (PTMa)ELISA kit |
201-12-2264 |
SunredBio |
96 tests |
EUR 440 |
- This Prothymosin Alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
SED221Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
SED221Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
SED221Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
SED221Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
4-SED221Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Prothymosin Alpha elisa. Alternative names of the recognized antigen: TMSA
- PTM-A
- Pro-Thymosin A
- Gene Sequence 28
- Thymosin alpha-1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prothymosin Alpha (PTMa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Prothymosin Alpha (PTMa) Antibody |
20-abx128206 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Prothymosin Alpha (PTMA) Antibody |
20-abx110156 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
20-abx121680 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
abx026432-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
abx026432-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMa) Antibody |
20-abx174300 |
Abbexa |
|
|
|
Prothymosin Alpha (PTMA) Antibody |
abx431948-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Prothymosin Alpha (PTMA) Antibody |
20-abx241156 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
20-abx241411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
20-abx241412 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
abx236808-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Prothymosin Alpha (PTMA) Protein |
20-abx262698 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Rat Prothymosin alpha (Ptma) |
1-CSB-YP019000RA |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 14.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Prothymosin alpha(Ptma) expressed in Yeast |
Recombinant Prothymosin Alpha (PTMa) |
4-RPD221Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P06454
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 42.1kDa
- Isoelectric Point: 3.7
|
Description: Recombinant Human Prothymosin Alpha expressed in: E.coli |
Recombinant Prothymosin Alpha (PTMa) |
4-RPD221Ra01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 42.2kDa
- Isoelectric Point: 3.7
|
Description: Recombinant Rat Recombinant Prothymosin Alpha (PTMa) expressed in: E.coli |
Cow Prothymosin alpha (PTMA) ELISA Kit |
abx517922-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Prothymosin alpha (PTMA) ELISA Kit |
abx517924-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Prothymosin alpha (PTMA) ELISA Kit |
abx517925-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Ptma/ Prothymosin alpha ELISA Kit |
E1227Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Prothymosin Alpha(PTMa)ELISA kit |
GA-E0811MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse Prothymosin Alpha(PTMa)ELISA kit |
GA-E0811MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
Human Prothymosin Alpha (PTMa) Protein |
20-abx166598 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Prothymosin Alpha (PTMA) Protein |
abx060044-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
Human Prothymosin alpha (PTMa) CLIA Kit |
20-abx494145 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human PTMa (Prothymosin Alpha) |
ELK3885 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prothymosin Alpha (PTM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prothymos
- Show more
|
Description: A sandwich ELISA kit for detection of Prothymosin Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Prothymosin, alpha (PTMA) |
KTE61059-48T |
Abbkine |
48T |
EUR 354 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Prothymosin, alpha (PTMA) |
KTE61059-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Prothymosin, alpha (PTMA) |
KTE61059-96T |
Abbkine |
96T |
EUR 572 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Rat Prothymosin Alpha (PTMa) Protein |
20-abx654881 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Canine Prothymosin, alpha (PTMA) |
KTE20099-48T |
Abbkine |
48T |
EUR 354 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Canine Prothymosin, alpha (PTMA) |
KTE20099-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Canine Prothymosin, alpha (PTMA) |
KTE20099-96T |
Abbkine |
96T |
EUR 572 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
PTMA Prothymosin Alpha Human Recombinant Protein |
PROTP06454-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: PTMA Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 133 amino acids (1-110) and having a molecular mass of 14.5 kDa.;PTMA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human) |
4-PAD221Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa) |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC |
4-PAD221Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Biotinylated |
4-PAD221Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Biotin. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Cy3 |
4-PAD221Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Cy3. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), FITC |
4-PAD221Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with FITC. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), HRP |
4-PAD221Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with HRP. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), PE |
4-PAD221Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with PE. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD221Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC-Cy7. |
ELISA kit for Human Prothymosin alpha |
EK3812 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Prothymosin alpha in samples from serum, plasma, tissue homogenates and other biological fluids. |
Prothymosin, alpha Antibody |
20-abx114891 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
anti- Prothymosin alpha antibody |
FNab06808 |
FN Test |
100µg |
EUR 585 |
- Immunogen: prothymosin, alpha
- Uniprot ID: P06454
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against Prothymosin alpha |
Prothymosin alpha Antibody (HRP) |
20-abx108684 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Prothymosin alpha Blocking Peptide |
20-abx161390 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prothymosin alpha Antibody (Biotin) |
20-abx105848 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Prothymosin alpha Antibody (FITC) |
20-abx107264 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Prothymosin alpha Polyclonal Antibody |
42262-100ul |
SAB |
100ul |
EUR 333 |
Prothymosin alpha Polyclonal Conjugated Antibody |
C42262 |
SAB |
100ul |
EUR 397 |
PTMA ELISA Kit (Human) (OKCD08419) |
OKCD08419 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL |
PTMA ELISA Kit (Human) (OKEH01154) |
OKEH01154 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.039 ng/mL |
PTMA |
E541-447 |
EnoGene |
100ug |
EUR 343 |
PTMA ELISA Kit (Mouse) (OKEH04264) |
OKEH04264 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.164 ng/mL |
PTMA ELISA Kit (Rat) (OKEH06132) |
OKEH06132 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL |
PTMA siRNA |
20-abx904361 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTMA siRNA |
20-abx930331 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTMA siRNA |
20-abx930332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTMA Antibody |
37277-100ul |
SAB |
100ul |
EUR 252 |
PTMA antibody |
70R-19633 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PTMA antibody |
PTMA Antibody |
1-CSB-PA799716 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
PTMA Antibody |
1-CSB-PA272943 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
PTMA Antibody |
1-CSB-PA721303 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
PTMA Antibody |
1-CSB-PA019000GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
PTMA Antibody |
1-CSB-PA01524A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
PTMS Prothymosin Human Recombinant Protein |
PROTP20962 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: PTMS Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 125 amino acids (1-102aa) and having a molecular mass of 13.9kDa. |
Human PTMA shRNA Plasmid |
20-abx953893 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PTMA Recombinant Protein (Human) |
RP025144 |
ABM |
100 ug |
Ask for price |
PTMA Recombinant Protein (Human) |
RP025147 |
ABM |
100 ug |
Ask for price |
Human TNF-alpha ELISA Kit, 96 tests, Quantitative |
100-215-TNH |
Alpha Diagnostics |
1 kit |
EUR 482 |
PTMA Conjugated Antibody |
C37277 |
SAB |
100ul |
EUR 397 |
Monoclonal PTMA Antibody |
AMM01760G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human PTMA. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC, IP |
PTMA cloning plasmid |
CSB-CL019000HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 333
- Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
- Show more
|
Description: A cloning plasmid for the PTMA gene. |
PTMA cloning plasmid |
CSB-CL019000HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 333
- Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
- Show more
|
Description: A cloning plasmid for the PTMA gene. |
PTMA Polyclonal Antibody |
ES11817-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PTMA Polyclonal Antibody |
ES11817-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PTMA Polyclonal Antibody |
ABP60026-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PTMA protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein |
PTMA Polyclonal Antibody |
ABP60026-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PTMA protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein |
PTMA Polyclonal Antibody |
ABP60026-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PTMA protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein |
PTMA Polyclonal Antibody |
A52464 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PTMA Rabbit pAb |
A1956-100ul |
Abclonal |
100 ul |
EUR 308 |
PTMA Rabbit pAb |
A1956-200ul |
Abclonal |
200 ul |
EUR 459 |
PTMA Rabbit pAb |
A1956-20ul |
Abclonal |
20 ul |
EUR 183 |
PTMA Rabbit pAb |
A1956-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-PTMA antibody |
STJ192975 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PTMA |
PTMA ORF Vector (Human) (pORF) |
ORF008382 |
ABM |
1.0 ug DNA |
EUR 95 |
PTMA ORF Vector (Human) (pORF) |
ORF008383 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Human Alpha Fetoprotein (AFP) ELISA Kit, 96 tests, Quantitative |
500 |
Alpha Diagnostics |
1 kit |
EUR 469 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Mouse alpha 2-Macroglobulin (A2M) ELISA kit |
600-720-A2M |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Human Anti-Alpha Fodrin IgG ELISA kit, 96 tests, Quantitative |
3300-160-AFG |
Alpha Diagnostics |
1 kit |
EUR 590 |
Human hypoxia-inducible transcription factor 1 alpha (HIF-1 alpha) ELISA Kit, 96 tests, Quantitative |
100-530-HIF |
Alpha Diagnostics |
1 Kit |
EUR 712 |
Rat PTMA shRNA Plasmid |
20-abx985361 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PTMA protein (His tag) |
80R-3024 |
Fitzgerald |
50 ug |
EUR 413 |
Description: Purified recombinant PTMA protein (His tag) |
Mouse PTMA shRNA Plasmid |
20-abx972279 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PTMA Antibody, HRP conjugated |
1-CSB-PA01524B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PTMA Antibody, FITC conjugated |
1-CSB-PA01524C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PTMA Antibody, Biotin conjugated |
1-CSB-PA01524D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PTMA Recombinant Protein (Rat) |
RP222875 |
ABM |
100 ug |
Ask for price |
PTMA Recombinant Protein (Mouse) |
RP165578 |
ABM |
100 ug |
Ask for price |
PTMA sgRNA CRISPR Lentivector set (Human) |
K1752701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Recombinant (E.Coli) Human p38 alpha/SAPK2 alpha |
RP-675 |
Alpha Diagnostics |
1 ug |
EUR 286 |
Mouse TNF-alpha ELISA Kit, 96 tests, Quantitative |
100-210-TNF |
Alpha Diagnostics |
1 kit |
EUR 482 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human Fodrin-alpha (spectrin-alpha) control/blocking peptide |
FOD11-P |
Alpha Diagnostics |
100 ug |
EUR 164 |
Rabbit Anti-Human Fodrin-alpha (spectrin-alpha) antiserum |
FOD11-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
Human 17 alpha Hydroxyprogesterone (17-OHP/17OHP) ELISA Kit, 96 tests, Quantitative |
1870 |
Alpha Diagnostics |
1 kit |
EUR 529 |
Human Zeta (z) Globin (alpha thalassemia ) ELISA Kit, 96 tests, Semi-Quantitative |
1970 |
Alpha Diagnostics |
1 kit |
EUR 651 |
Monkey Interferon-alpha (IFN-?) ELISA Kit, 96 tests, Quantitative |
9745 |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Pig Alpha Fetoprotein (?FP) ELISA Kit, 96 tests, Quantitative |
9930 |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Pig Interferon alpha (IFN-?) ELISA Kit, 96 tests, Quantitative |
9945 |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Chicken Interferon alpha (IFN-?) ELISA Kit, 96 tests, Quantitative |
10680 |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Mouse IL-1 alpha ELISA Kit, 96 tests, Quantitative |
MIL-01A-145 |
Alpha Diagnostics |
1 kit |
EUR 482 |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PTMA sgRNA CRISPR Lentivector (Human) (Target 1) |
K1752702 |
ABM |
1.0 ug DNA |
EUR 154 |
PTMA sgRNA CRISPR Lentivector (Human) (Target 2) |
K1752703 |
ABM |
1.0 ug DNA |
EUR 154 |
PTMA sgRNA CRISPR Lentivector (Human) (Target 3) |
K1752704 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human PTMA Protein, His, E.coli-10ug |
QP13206-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human PTMA Protein, His, E.coli-1mg |
QP13206-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human PTMA Protein, His, E.coli-2ug |
QP13206-2ug |
EnQuireBio |
2ug |
EUR 155 |
PTMA Protein Vector (Human) (pPB-C-His) |
PV033525 |
ABM |
500 ng |
EUR 329 |
PTMA Protein Vector (Human) (pPB-N-His) |
PV033526 |
ABM |
500 ng |
EUR 329 |
PTMA Protein Vector (Human) (pPM-C-HA) |
PV033527 |
ABM |
500 ng |
EUR 329 |
PTMA Protein Vector (Human) (pPM-C-His) |
PV033528 |
ABM |
500 ng |
EUR 329 |
PTMA Protein Vector (Human) (pPB-C-His) |
PV033529 |
ABM |
500 ng |
EUR 329 |
PTMA Protein Vector (Human) (pPB-N-His) |
PV033530 |
ABM |
500 ng |
EUR 329 |
PTMA Protein Vector (Human) (pPM-C-HA) |
PV033531 |
ABM |
500 ng |
EUR 329 |
PTMA Protein Vector (Human) (pPM-C-His) |
PV033532 |
ABM |
500 ng |
EUR 329 |
Polyclonal PTMA Antibody (C-Term) |
APG00574G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal PTMA Antibody (C-Terminus) |
APG01175G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal PTMA Antibody (N-term) |
APR03615G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTMA (N-term). This antibody is tested and proven to work in the following applications: |
PTMA Polyclonal Antibody, Biotin Conjugated |
A52461 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PTMA Polyclonal Antibody, FITC Conjugated |
A52462 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PTMA Polyclonal Antibody, HRP Conjugated |
A52463 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Ptma ORF Vector (Rat) (pORF) |
ORF074293 |
ABM |
1.0 ug DNA |
EUR 506 |
Ptma ORF Vector (Mouse) (pORF) |
ORF055194 |
ABM |
1.0 ug DNA |
EUR 506 |
Rabbit Anti-Human Glutathione Transferase alpha (GST-alpha) antiserum |
GSTA12-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
human Topoisomerase II alpha (TOP2 alpha) Control/blocking peptide |
TOP2A11-P |
Alpha Diagnostics |
100 ug |
EUR 164 |
Human IL-2 receptor alpha, soluble (IL2RsA/CD25) ELISA Kit, 96 tests, quantitative |
210-340-I2R |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Human Alpha-Thrombin (human plasma), purified |
TBNA16-N-100 |
Alpha Diagnostics |
100 ug |
EUR 164 |
Mouse Alpha defensin 1 (DEFa1) ELISA Kit, 96 tests, Quantitative |
9205 |
Alpha Diagnostics |
1 Kit |
EUR 895 |
Mouse Estrogen Receptor Alpha (ER?) ELISA Kit, 96 tests, Quantitative |
9265 |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Guinea pig Interferon-alpha (IFN-?) ELISA Kit, 96 tests, Quantitative |
9880 |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Horse Interleukin 1 alpha (IL1a) ELISA Kit, 96 tests, Quantitative |
10515 |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Rat TNF-alpha ELISA Kit, High Sensitivity, 96 tests, Quantitative |
100-205-TNR |
Alpha Diagnostics |
1 kit |
EUR 482 |
Rat alpha 2-Macroglobulin (A2M) ELISA kit 96 tests, Quantitative |
610-420-A2M |
Alpha Diagnostics |
1 Kit |
EUR 773 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Rabbit Anti-Human Fodrin-alpha (spectrin-alpha) IgG, aff pure |
FOD11-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Rabbit Anti-Human Estrogen receptor alpha (ER-alpha) peptide IgG |
ERA12-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Recombinant purified, human Interleukin-1 alpha (IL-1 alpha), active |
IL1A15-R-10 |
Alpha Diagnostics |
10 ug |
EUR 347 |
Human Recombinant Transforming Growth Factor-alpha (TGF-alpha), biologically active |
TGFA15-R-100 |
Alpha Diagnostics |
100 ug |
EUR 529 |
Human Recombinant Transforming Growth Factor-alpha (TGF-alpha), biologically active |
TGFA15-R-1000 |
Alpha Diagnostics |
1000 ug |
EUR 3521 |
Human Recombinant Transforming Growth Factor-alpha (TGF-alpha), biologically active |
TGFA15-R-20 |
Alpha Diagnostics |
20 ug |
EUR 225 |
Alpha 1-Antichymotrypsin , Human Plasma |
A1CT15-N-100 |
Alpha Diagnostics |
100 ug |
EUR 164 |
Recombinant (E.Coli) Human Thyrostimulin Alpha |
RP-595 |
Alpha Diagnostics |
10 ug |
EUR 286 |
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human PTMa(Prothymosin Alpha) ELISA Kit