Human PVR(Poliovirus Receptor) ELISA Kit

Human PVR(Poliovirus Receptor) ELISA Kit

Human Poliovirus Receptor (PVR) ELISA Kit
RD-PVR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Poliovirus Receptor (PVR) ELISA Kit
RDR-PVR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Poliovirus Receptor (PVR) ELISA Kit
RDR-PVR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Poliovirus receptor (PVR)
1-CSB-EP019093HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 51.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Poliovirus receptor(PVR),partial expressed in E.coli

Human Poliovirus receptor (PVR)
1-CSB-CF019093HU	Cusabio	EUR 1340.00 EUR 614.00 EUR 870.00	1MG 200ug 500ug
MW: 46.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Poliovirus receptor(PVR) expressed in in vitro E.coli expression system

Human Poliovirus receptor, PVR ELISA KIT
ELI-37925h	Lifescience Market	96 Tests	EUR 824

Human Poliovirus Receptor (PVR) ELISA Kit
20-abx152801	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Poliovirus receptor(PVR) ELISA kit
CSB-EL019093HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Poliovirus receptor (PVR) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Poliovirus receptor(PVR) ELISA kit
1-CSB-EL019093HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Poliovirus receptor(PVR) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Poliovirus Receptor (PVR) ELISA Kit
SEB550Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor (PVR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor (PVR) in serum, plasma, tissue homogenates and other biological fluids.

Human Poliovirus Receptor (PVR) ELISA Kit
SEB550Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor (PVR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor (PVR) in serum, plasma, tissue homogenates and other biological fluids.

Human Poliovirus Receptor (PVR) ELISA Kit
SEB550Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor (PVR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor (PVR) in serum, plasma, tissue homogenates and other biological fluids.

Human Poliovirus Receptor (PVR) ELISA Kit
SEB550Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor (PVR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor (PVR) in serum, plasma, tissue homogenates and other biological fluids.

Human Poliovirus Receptor (PVR) ELISA Kit
4-SEB550Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Poliovirus Receptor elisa. Alternative names of the recognized antigen: CD155 HVED Necl-5 Tage4 Nectin-Like Protein 5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Poliovirus Receptor (PVR) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Poliovirus Receptor ELISA Kit (PVR)
RK02170	Abclonal	96 Tests	EUR 521

Human Poliovirus Receptor(PVR)ELISA Kit
QY-E02931	Qayee Biotechnology	96T	EUR 361

Poliovirus Receptor (PVR) Antibody
20-abx127023	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Poliovirus Receptor (PVR) Antibody
20-abx130344	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Poliovirus Receptor (PVR) Antibody
20-abx101800	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Poliovirus Receptor (PVR) Antibody
20-abx004402	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Poliovirus Receptor (PVR) Antibody
abx031329-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Poliovirus Receptor (PVR) Antibody
abx031329-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Poliovirus Receptor (PVR) Antibody
20-abx174127	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Poliovirus Receptor (PVR) Antibody
20-abx320390	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Poliovirus Receptor (PVR) Antibody
20-abx322274	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Poliovirus Receptor (PVR) Antibody
20-abx327197	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Poliovirus Receptor (PVR) Antibody
20-abx339474	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Poliovirus Receptor (PVR)
4-RPB550Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P15151 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.4kDa Isoelectric Point: 6.9
Description: Recombinant Human Poliovirus Receptor expressed in: E.coli

Recombinant Poliovirus Receptor (PVR)
4-RPB550Ra01	Cloud-Clone	EUR 537.25 EUR 247.00 EUR 1739.68 EUR 646.56 EUR 1193.12 EUR 422.00 EUR 4199.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5U334 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.0kDa Isoelectric Point: Inquire
Description: Recombinant Rat Poliovirus Receptor expressed in: E.coli

ELISA kit for Human PVR (Poliovirus Receptor)
ELK3972	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Poliovirus Receptor (PVR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Poliovir Show more
Description: A sandwich ELISA kit for detection of Poliovirus Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Poliovirus receptor (PVR)
KTE61035-48T	Abbkine	48T	EUR 332
CD155 is a Type I transmembrane glycoprotein in the immunoglobulin superfamily. Commonly known as Poliovirus Receptor (PVR) due to its involvement in the cellular poliovirus infection in primates, CD155's normal cellular function is in the establishm Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor (PVR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Poliovirus receptor (PVR)
KTE61035-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
CD155 is a Type I transmembrane glycoprotein in the immunoglobulin superfamily. Commonly known as Poliovirus Receptor (PVR) due to its involvement in the cellular poliovirus infection in primates, CD155's normal cellular function is in the establishm Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor (PVR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Poliovirus receptor (PVR)
KTE61035-96T	Abbkine	96T	EUR 539
CD155 is a Type I transmembrane glycoprotein in the immunoglobulin superfamily. Commonly known as Poliovirus Receptor (PVR) due to its involvement in the cellular poliovirus infection in primates, CD155's normal cellular function is in the establishm Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor (PVR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Poliovirus Receptor (PVR) Protein
20-abx068619	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Poliovirus Receptor (PVR) CLIA Kit
20-abx492861	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Poliovirus receptor (PVR) polyclonal antibody
ABP-PAB-11267	Allele Biotech	100 ug	Ask for price
Product line: Cell Surface Molecules / GPCRs Brand:

Rat Poliovirus Receptor (PVR) Protein
20-abx168558	Abbexa	EUR 746.00 EUR 300.00 EUR 2346.00 EUR 899.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Poliovirus Receptor (PVR) Antibody (FITC)
20-abx274494	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

PVR Poliovirus Receptor Human Recombinant Protein
PROTP15151	BosterBio	Regular: 5ug	EUR 317
Description: PVR Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 331 amino acids (21-343 a.a.) and having a molecular mass of 36.1kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). PVR is expressed with an 8 amino acids His tag at C-Terminus and purified by proprietary chromatographic techniques.

Poliovirus Receptor (PVR) Polyclonal Antibody (Rat)
4-PAB550Ra01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Leu22~Ile255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR)

Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse)
4-PAB550Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Met56~Thr309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR)

Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), APC
4-PAB550Ra01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Leu22~Ile255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with APC.

Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), Biotinylated
4-PAB550Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Leu22~Ile255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with Biotin.

Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), Cy3
4-PAB550Ra01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Leu22~Ile255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with Cy3.

Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), FITC
4-PAB550Ra01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Leu22~Ile255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with FITC.

Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), HRP
4-PAB550Ra01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Leu22~Ile255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with HRP.

Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), PE
4-PAB550Ra01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Leu22~Ile255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with PE.

Recombinant Human Poliovirus Receptor/PVR/CD155 (C-6His)
C622-10ug	Novoprotein	10ug	EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Poliovirus Receptor/PVR/CD155 (C-6His)
C622-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Poliovirus Receptor/PVR/CD155 (C-6His)
C622-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Recombinant Human Poliovirus Receptor/PVR/CD155 (C-6His)
C622-50ug	Novoprotein	50ug	EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), APC
4-PAB550Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Met56~Thr309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with APC.

Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAB550Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Met56~Thr309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with Biotin.

Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), Cy3
4-PAB550Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Met56~Thr309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with Cy3.

Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), FITC
4-PAB550Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Met56~Thr309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with FITC.

Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), HRP
4-PAB550Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Met56~Thr309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with HRP.

Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), PE
4-PAB550Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Met56~Thr309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with PE.

Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAB550Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Met56~Thr309) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with APC-Cy7.

Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), APC-Cy7
4-PAB550Ra01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PVR (Leu22~Ile255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with APC-Cy7.

anti-Poliovirus receptor
YF-PA14226	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Poliovirus receptor

anti-Poliovirus receptor
YF-PA24528	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Poliovirus receptor

PVR ELISA Kit (Human) (OKCD00114)
OKCD00114	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Mediates NK cell adhesion and triggers NK cell effector functions. Binds two different NK cell receptors: CD96 and CD226. These interactions accumulates at the cell-cell contact site, leading to the formation of a mature immunological synapse between NK cell and target cell. This may trigger adhesion and secretion of lytic granules and IFN-gamma and activate cytoxicity of activated NK cells. May also promote NK cell-target cell modular exchange, and PVR transfer to the NK cell. This transfer is more important in some tumor cells expressing a lot of PVR, and may trigger fratricide NK cell activation, providing tumors with a mechanism of immunoevasion. Plays a role in mediating tumor cell invasion and migration.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.17"CD155/PVR plays a key role in cell motility during tumor cell invasion and migration."_x005F_x005F_x000D_Sloan K.E., Eustace B.K., Stewart J.K., Zehetmeier C., Torella C., Simeone M., Roy J.E., Unger C., Louis D.N., Ilag L.L., Jay D.G._x005F_x005F_x000D_BMC Cancer 4:73-73(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.21"PVR (CD155) and Nectin-2 (CD112) as ligands of the human DNAM-1 (CD226) activating receptor: involvement in tumor cell lysis."_x005F_x005F_x000D_Pende D., Bottino C., Castriconi R., Cantoni C., Marcenaro S., Rivera P., Spaggiari G.M., Dondero A., Carnemolla B., Reymond N., Mingari M.C., Lopez M., Moretta L., Moretta A._x005F_x005F_x000D_Mol. Immunol. 42:463-469(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION. (Microbial infection) Acts as a receptor for poliovirus. May play a role in axonal transport of poliovirus, by targeting virion-PVR-containing endocytic vesicles to the microtubular network through interaction with DYNLT1. This interaction would drive the virus-containing vesicle to the axonal retrograde transport (PubMed:2538245). Acts as a receptor for pseudorabies virus (PubMed:9616127). Is prevented to reach cell surface upon infection by human cytomegalovirus /HHV-5, presumably to escape immune recognition of infected cell by NK cells (PubMed:15640804).3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Cellular receptor for poliovirus: molecular cloning, nucleotide sequence, and expression of a new member of the immunoglobulin superfamily."_x005F_x005F_x000D_Mendelsohn C.L., Wimmer E., Racaniello V.R._x005F_x005F_x000D_Cell 56:855-865(1989) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA], FUNCTION (MICROBIAL INFECTION), INTERACTION WITH POLIOVIRUS CAPSID PROTEINS.Ref.9"Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor."_x005F_x005F_x000D_Geraghty R.J., Krummenacher C., Cohen G.H., Eisenberg R.J., Spear P.G._x005F_x005F_x000D_Science 280:1618-1620(1998) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION (MICROBIAL INFECTION), INTERACTION WITH PSEUDORAVIES VIRUS GD PROTEIN.Ref.22"Downregulation of natural killer cell-activating ligand CD155 by human cytomegalovirus UL141."_x005F_x005F_x000D_Tomasec P., Wang E.C., Davison A.J., Vojtesek B., Armstrong M., Griffin C., McSharry B.P., Morris R.J., Llewellyn-Lacey S., Rickards C., Nomoto A., Sinzger C., Wilkinson G.W._x005F_x005F_x000D_Nat. Immunol. 6:181-188(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION (MICROBIAL INFECTION), INTERACTION WITH HHV-5 UL141. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.0 pg/mL

PVR ELISA Kit (Human) (OKBB01249)
OKBB01249	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: CD155 (cluster of differentiation 155) also known as the poliovirus receptor is a protein that in humans is encoded by the PVR gene. It is mapped to 19q13.31. The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

PVR ELISA Kit (Human) (OKEH08313)
OKEH08313	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063ng/mL

Human PVRL1/ Poliovirus receptor-related protein 1 ELISA Kit
E2100Hu	Sunlong	1 Kit	EUR 571

Human PVRL1(Poliovirus receptor-related protein 1) ELISA Kit
EH1893	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q15223 Alias: PVRL1/Poliovirus receptor-related protein 1/Nectin-1/Herpes virus entry mediator C/Herpesvirus entry mediator C/HveC/Herpesvirus Ig-like receptor/HIgR/HVEC/PRR1/CD111/PVRR1/SK-12
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Poliovirus receptor- related protein 4, PVRL4 ELISA KIT
ELI-14050h	Lifescience Market	96 Tests	EUR 824

Human Poliovirus receptor- related protein 1, PVRL1 ELISA KIT
ELI-05552h	Lifescience Market	96 Tests	EUR 824

Human Poliovirus receptor- related protein 2, PVRL2 ELISA KIT
ELI-45481h	Lifescience Market	96 Tests	EUR 824

Human Poliovirus receptor- related protein 3, PVRL3 ELISA KIT
ELI-30533h	Lifescience Market	96 Tests	EUR 824

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
DLR-PVRL1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
DLR-PVRL1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
DLR-PVRL4-Hu-48T	DL Develop	48T	EUR 517
Should the Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
DLR-PVRL4-Hu-96T	DL Develop	96T	EUR 673
Should the Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
SEB470Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 1 (PVRL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
SEB470Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 1 (PVRL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
SEB470Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 1 (PVRL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
SEB470Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 1 (PVRL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
4-SEB470Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Poliovirus Receptor Related Protein 1 elisa. Alternative names of the recognized antigen: CD111 HVEC PRR1 CLPED1 ED4 HIgR OFC7 PRR PVRR1 SK12 Nectin 1 Herpesvirus Entry Mediator C Herpesvirus Ig-like receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
SEC757Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 4 (PVRL4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
SEC757Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 4 (PVRL4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
SEC757Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 4 (PVRL4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
SEC757Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 4 (PVRL4) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Int Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
4-SEC757Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Poliovirus Receptor Related Protein 4 elisa. Alternative names of the recognized antigen: PRR4 LNIR Nectin-4 Ig superfamily receptor LNIR Processed poliovirus receptor-related protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Poliovirus Receptor Related Protein 1 ELISA Kit (PVRL1)
RK02171	Abclonal	96 Tests	EUR 521

Human Poliovirus Receptor Related Protein 4 ELISA Kit (PVRL4)
RK02172	Abclonal	96 Tests	EUR 521

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
RD-PVRL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
RD-PVRL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
RD-PVRL4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
RD-PVRL4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
RDR-PVRL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
RDR-PVRL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
RDR-PVRL4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
RDR-PVRL4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Poliovirus Receptor Related Protein 4(PVRL4)ELISA Kit
QY-E02930	Qayee Biotechnology	96T	EUR 361

Human CD155/PVR PicoKine ELISA Kit
EK1831	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human CD155/PVR in cell culture supernates, serum and plasma (heparin, EDTA).

Recombinant (HEK) HUman Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, his-tag, >95%)
PVR18-R-25	Alpha Diagnostics	25 ug	EUR 286

Human Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx571614-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human PVRL4 (Poliovirus Receptor Related Protein 4)
ELK2960	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Poliovirus Receptor Related Protein 4 (PVRL4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody Show more
Description: A sandwich ELISA kit for detection of Poliovirus Receptor Related Protein 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human PVRL1 (Poliovirus Receptor Related Protein 1)
ELK4424	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Poliovirus Receptor Related Protein 1 (PVRL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody Show more
Description: A sandwich ELISA kit for detection of Poliovirus Receptor Related Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
20-abx152901	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Poliovirus Receptor Related Protein 4 / PVRL4 (NECTIN4) ELISA Kit
20-abx152902	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Poliovirus Receptor Related Immunoglobulin Domain Containing (PVRIG) ELISA Kit
abx382582-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx251210-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

ELISA kit for Human Poliovirus receptor-related protein 4 (PVRL4)
KTE61033-48T	Abbkine	48T	EUR 332
Poliovirus receptor-like proteins (PVRLs), such as PVRL4, are adhesion receptors of the immunoglobulin superfamily and function in cell-cell adhesion (Reymond et al., 2001). By database analysis, Reymond et al. (2001) identified the PVRL4 gene, which Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 4 (PVRL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Poliovirus receptor-related protein 4 (PVRL4)
KTE61033-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Poliovirus receptor-like proteins (PVRLs), such as PVRL4, are adhesion receptors of the immunoglobulin superfamily and function in cell-cell adhesion (Reymond et al., 2001). By database analysis, Reymond et al. (2001) identified the PVRL4 gene, which Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 4 (PVRL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Poliovirus receptor-related protein 4 (PVRL4)
KTE61033-96T	Abbkine	96T	EUR 539
Poliovirus receptor-like proteins (PVRLs), such as PVRL4, are adhesion receptors of the immunoglobulin superfamily and function in cell-cell adhesion (Reymond et al., 2001). By database analysis, Reymond et al. (2001) identified the PVRL4 gene, which Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 4 (PVRL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Poliovirus receptor-related protein 1 (PVRL1)
KTE61034-48T	Abbkine	48T	EUR 332
PVRL1, or nectin-1, belongs to the nectin subfamily of immunoglobulin-like adhesion molecules that participate in Ca(2+)-independent cell-cell adhesion. Nectins bind to the actin cytoskeleton through the adaptor protein afadin (MLLT4) and are key com Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 1 (PVRL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Poliovirus receptor-related protein 1 (PVRL1)
KTE61034-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
PVRL1, or nectin-1, belongs to the nectin subfamily of immunoglobulin-like adhesion molecules that participate in Ca(2+)-independent cell-cell adhesion. Nectins bind to the actin cytoskeleton through the adaptor protein afadin (MLLT4) and are key com Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 1 (PVRL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Poliovirus receptor-related protein 1 (PVRL1)
KTE61034-96T	Abbkine	96T	EUR 539
PVRL1, or nectin-1, belongs to the nectin subfamily of immunoglobulin-like adhesion molecules that participate in Ca(2+)-independent cell-cell adhesion. Nectins bind to the actin cytoskeleton through the adaptor protein afadin (MLLT4) and are key com Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 1 (PVRL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Poliovirus Receptor-Related 3 Antibody
20-abx114561	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Mouse Poliovirus receptor-related protein 1
EK3896	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Poliovirus receptor-related protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Pvrl1/ Poliovirus receptor-related protein 1 ELISA Kit
E1233Mo	Sunlong	1 Kit	EUR 571

Mouse Poliovirus receptor- related protein 1, Pvrl1 ELISA KIT
ELI-05550m	Lifescience Market	96 Tests	EUR 865

Porcine Poliovirus receptor- related protein 1, PVRL1 ELISA KIT
ELI-05551p	Lifescience Market	96 Tests	EUR 928

Mouse Poliovirus receptor- related protein 2, Pvrl2 ELISA KIT
ELI-16765m	Lifescience Market	96 Tests	EUR 865

Bovine Poliovirus receptor- related protein 4, PVRL4 ELISA KIT
ELI-16766b	Lifescience Market	96 Tests	EUR 928

Mouse Poliovirus receptor- related protein 3, Pvrl3 ELISA KIT
ELI-42932m	Lifescience Market	96 Tests	EUR 865

Mouse Poliovirus receptor- related protein 4, Pvrl4 ELISA KIT
ELI-44453m	Lifescience Market	96 Tests	EUR 865

Mouse PVRL1( Poliovirus receptor-related protein 1) ELISA Kit
EM0670	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9JKF6 Alias: PVRL1/CD111/HVEC/PRR1/PVRR1/CD111/CD111 antigen/CLPED1ectodermal dysplasia 4(Margarita Island type)/ED4/Herpes virus entry mediator C/Herpesvirus entry mediator C/Herpesvirus Ig-like receptor/ Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse PVRL2(Poliovirus Receptor Related Protein 2) ELISA Kit
EM1323	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: P32507 Alias: PVRL2/Poliovirus Receptor Related Protein 2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml

Recombinant (HEK) Human Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, hIgG1-Fc-his, >95%)
PVR17-R-25	Alpha Diagnostics	25 ug	EUR 286

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Poliovirus receptor-related protein 4 (NECTIN4)
1-CSB-YP822274HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 36.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Poliovirus receptor-related protein 4(NECTIN4),partial expressed in Yeast

Recombinant (HEK) Mouse Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, his-tag, >95%)
PVR16-R-25	Alpha Diagnostics	25 ug	EUR 286

Recombinant (HEK) Mouse Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, His-tag, >95%)
PVR16-R-50	Alpha Diagnostics	50 ug	EUR 469

Human Poliovirus Receptor Related Protein 4 (PVRL4) CLIA Kit
20-abx493884	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Poliovirus Receptor Related Protein 1 (PVRL1) CLIA Kit
20-abx492777	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

PVR siRNA
20-abx930486	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PVR Antibody
33018-100ul	SAB	100ul	EUR 252

PVR Antibody
1-CSB-PA006288	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PVR. Recognizes PVR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

PVR Antibody
1-CSB-PA297000	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PVR. Recognizes PVR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PVR Antibody
1-CSB-PA019093ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PVR. Recognizes PVR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PVR Antibody
1-CSB-PA019093ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PVR. Recognizes PVR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Pig Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx518213-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Mouse PVRL1 (Poliovirus Receptor Related Protein 1)
E-EL-M0934	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PVRL1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse PVRL1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse PVRL1 (Poliovirus Receptor Related Protein 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse PVRL2 (Poliovirus Receptor Related Protein 2)
E-EL-M0935	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PVRL2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse PVRL2. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse PVRL2 (Poliovirus Receptor Related Protein 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse PVRL3 (Poliovirus Receptor Related Protein 3)
E-EL-M0936	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PVRL3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse PVRL3. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse PVRL3 (Poliovirus Receptor Related Protein 3) in samples from Serum, Plasma, Cell supernatant

PVRL1 ELISA Kit| Mouse Poliovirus receptor-related protein 1 EL
EF013285	Lifescience Market	96 Tests	EUR 689

PVRL2 ELISA Kit| Mouse Poliovirus Receptor Related Protein 2 ELI
EF013858	Lifescience Market	96 Tests	EUR 689

Mouse Poliovirus Receptor Related Protein 3 / PVRL3 (NECTIN3) ELISA Kit
abx352972-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx353854-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Poliovirus Receptor Related Protein 2 / PVRL2 (NECTIN2) ELISA Kit
abx353855-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Mouse Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx255020-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Mouse Poliovirus Receptor Related Protein 2 / PVRL2 (NECTIN2) ELISA Kit
abx254380-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

ELISA kit for Rat PVRL1 (Poliovirus Receptor Related Protein 1)
E-EL-R0765	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PVRL1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PVRL1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PVRL1 (Poliovirus Receptor Related Protein 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat PVRL2 (Poliovirus Receptor Related Protein 2)
E-EL-R0766	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PVRL2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PVRL2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PVRL2 (Poliovirus Receptor Related Protein 2) in samples from Serum, Plasma, Cell supernatant

Recombinant (HEK) Mouse Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, hIgG1-Fc-his, >95%)
PVR15-R-25	Alpha Diagnostics	25 ug	EUR 286

Recombinant (HEK) Mouse Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, hIgG1-Fc-His, >95%)
PVR15-R-50	Alpha Diagnostics	50 ug	EUR 469

Human PVR shRNA Plasmid
20-abx953932	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PVR Recombinant Protein (Human)
RP025297	ABM	100 ug	Ask for price

Human Poliovirus Receptor Related Protein 1 (PVRL1) Protein
20-abx654781	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Poliovirus Receptor Related Protein 2 (PVRL2) Protein
20-abx068620	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Poliovirus Receptor Related Protein 3 (PVRL3) Protein
20-abx068624	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Poliovirus Receptor Related Protein 4 (PVRL4) Protein
20-abx166149	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Poliovirus Receptor Related Protein 1 (PVRL1) Antibody
abx117183-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
20-abx114560	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
20-abx128454	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
abx122022-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Poliovirus receptor-related 1 (PVRL1) polyclonal antibody
ABP-PAB-11266	Allele Biotech	100 ug	Ask for price
Product line: Cell Surface Molecules / GPCRs Brand:

Poliovirus Receptor Related Protein 1 (PVRL1) Antibody
20-abx001654	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
20-abx104033	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
20-abx104034	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Poliovirus Receptor Related Protein 3 (PVRL3) Antibody
20-abx104035	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Poliovirus Receptor Related Protein 3 (PVRL3) Antibody
20-abx104036	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
20-abx004119	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Poliovirus Receptor Related Protein 3 (PVRL3) Antibody
abx027068-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Poliovirus Receptor Related Protein 3 (PVRL3) Antibody
abx027068-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
abx029867-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
abx029867-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Poliovirus Receptor Related Protein 1 (PVRL1) Antibody
20-abx174128	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
20-abx174129	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Poliovirus Receptor Related Protein 1 (PVRL1) Antibody
20-abx178068	Abbexa	EUR 1149.00 EUR 565.00	1 mg 200 ug
Please enquire.

Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
abx340224-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
20-abx270082	Abbexa	EUR 467.00 EUR 537.00 EUR 272.00 EUR 815.00 EUR 356.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-7 working days.

Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
abx236962-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Poliovirus Receptor Related Protein 4 (PVRL4)
4-RPC757Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q96NY8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Poliovirus Receptor Related Protein 4 expressed in: E.coli

Recombinant Poliovirus Receptor Related Protein 2 (PVRL2)
4-RPB474Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q92692 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.8kDa Isoelectric Point: 5.9
Description: Recombinant Human Poliovirus Receptor Related Protein 2 expressed in: E.coli

Recombinant Poliovirus Receptor Related Protein 2 (PVRL2)
4-RPB474Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P32507 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.8kDa Isoelectric Point: 5.8
Description: Recombinant Mouse Poliovirus Receptor Related Protein 2 expressed in: E.coli

Recombinant Poliovirus Receptor Related Protein 3 (PVRL3)
4-RPB475Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9NQS3 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.6kDa Isoelectric Point: 6.6
Description: Recombinant Human Poliovirus Receptor Related Protein 3 expressed in: E.coli

Recombinant Poliovirus Receptor Related Protein 3 (PVRL3)
4-RPB475Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9JLB9 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.1kDa Isoelectric Point: 7.8
Description: Recombinant Mouse Poliovirus Receptor Related Protein 3 expressed in: E.coli

PVR Conjugated Antibody
C33018	SAB	100ul	EUR 397

PVR cloning plasmid
CSB-CL019093HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1254 Sequence: atggcccgagccatggccgccgcgtggccgctgctgctggtggcgctactggtgctgtcctggccacccccaggaaccggggacgtcgtcgtgcaggcgcccacccaggtgcccggcttcttgggcgactccgtgacgctgccctgctacctacaggtgcccaacatggaggtga Show more
Description: A cloning plasmid for the PVR gene.

PVR Rabbit pAb
A11824-100ul	Abclonal	100 ul	EUR 308

PVR Rabbit pAb
A11824-200ul	Abclonal	200 ul	EUR 459

PVR Rabbit pAb
A11824-20ul	Abclonal	20 ul	Ask for price

PVR Rabbit pAb
A11824-50ul	Abclonal	50 ul	Ask for price

PVR Rabbit pAb
A5753-100ul	Abclonal	100 ul	EUR 308

PVR Rabbit pAb
A5753-200ul	Abclonal	200 ul	EUR 459

PVR Rabbit pAb
A5753-20ul	Abclonal	20 ul	EUR 183

PVR Rabbit pAb
A5753-50ul	Abclonal	50 ul	EUR 223

Human PVR(Poliovirus Receptor) ELISA Kit