
Human brain gene expression atlas project

Human PVR(Poliovirus Receptor) ELISA Kit

Human PVR(Poliovirus Receptor) ELISA Kit

Human Poliovirus Receptor (PVR) ELISA Kit
RD-PVR-Hu-96Tests 96 Tests
EUR 692
Human Poliovirus Receptor (PVR) ELISA Kit
RDR-PVR-Hu-48Tests 48 Tests
EUR 522
Human Poliovirus Receptor (PVR) ELISA Kit
RDR-PVR-Hu-96Tests 96 Tests
EUR 724
Human Poliovirus receptor (PVR)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 51.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Poliovirus receptor(PVR),partial expressed in E.coli
Human Poliovirus receptor (PVR)
  • EUR 1340.00
  • EUR 614.00
  • EUR 870.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 46.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Poliovirus receptor(PVR) expressed in in vitro E.coli expression system
Human Poliovirus receptor, PVR ELISA KIT
ELI-37925h 96 Tests
EUR 824
Human Poliovirus Receptor (PVR) ELISA Kit
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Poliovirus receptor(PVR) ELISA kit
CSB-EL019093HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Poliovirus receptor (PVR) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Poliovirus receptor(PVR) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Poliovirus receptor(PVR) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Poliovirus Receptor (PVR) ELISA Kit
SEB550Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor (PVR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor (PVR) in serum, plasma, tissue homogenates and other biological fluids.
Human Poliovirus Receptor (PVR) ELISA Kit
SEB550Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor (PVR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor (PVR) in serum, plasma, tissue homogenates and other biological fluids.
Human Poliovirus Receptor (PVR) ELISA Kit
SEB550Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor (PVR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor (PVR) in serum, plasma, tissue homogenates and other biological fluids.
Human Poliovirus Receptor (PVR) ELISA Kit
SEB550Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor (PVR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor (PVR) in serum, plasma, tissue homogenates and other biological fluids.
Human Poliovirus Receptor (PVR) ELISA Kit
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Poliovirus Receptor elisa. Alternative names of the recognized antigen: CD155
  • HVED
  • Necl-5
  • Tage4
  • Nectin-Like Protein 5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Poliovirus Receptor (PVR) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Poliovirus Receptor ELISA Kit (PVR)
RK02170 96 Tests
EUR 521
Human Poliovirus Receptor(PVR)ELISA Kit
QY-E02931 96T
EUR 361
Poliovirus Receptor (PVR) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Poliovirus Receptor (PVR) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Poliovirus Receptor (PVR) Antibody
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Poliovirus Receptor (PVR) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Poliovirus Receptor (PVR) Antibody
abx031329-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Poliovirus Receptor (PVR) Antibody
abx031329-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Poliovirus Receptor (PVR) Antibody
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Poliovirus Receptor (PVR) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Poliovirus Receptor (PVR) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Poliovirus Receptor (PVR) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Poliovirus Receptor (PVR) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Poliovirus Receptor (PVR)
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P15151
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.4kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Poliovirus Receptor expressed in: E.coli
Recombinant Poliovirus Receptor (PVR)
  • EUR 537.25
  • EUR 247.00
  • EUR 1739.68
  • EUR 646.56
  • EUR 1193.12
  • EUR 422.00
  • EUR 4199.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5U334
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Poliovirus Receptor expressed in: E.coli
ELISA kit for Human PVR (Poliovirus Receptor)
ELK3972 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Poliovirus Receptor (PVR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Poliovir
  • Show more
Description: A sandwich ELISA kit for detection of Poliovirus Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Poliovirus receptor (PVR)
KTE61035-48T 48T
EUR 332
  • CD155 is a Type I transmembrane glycoprotein in the immunoglobulin superfamily. Commonly known as Poliovirus Receptor (PVR) due to its involvement in the cellular poliovirus infection in primates, CD155's normal cellular function is in the establishm
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor (PVR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Poliovirus receptor (PVR)
KTE61035-5platesof96wells 5 plates of 96 wells
EUR 2115
  • CD155 is a Type I transmembrane glycoprotein in the immunoglobulin superfamily. Commonly known as Poliovirus Receptor (PVR) due to its involvement in the cellular poliovirus infection in primates, CD155's normal cellular function is in the establishm
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor (PVR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Poliovirus receptor (PVR)
KTE61035-96T 96T
EUR 539
  • CD155 is a Type I transmembrane glycoprotein in the immunoglobulin superfamily. Commonly known as Poliovirus Receptor (PVR) due to its involvement in the cellular poliovirus infection in primates, CD155's normal cellular function is in the establishm
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor (PVR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Poliovirus Receptor (PVR) Protein
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Poliovirus Receptor (PVR) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Poliovirus receptor (PVR) polyclonal antibody
ABP-PAB-11267 100 ug Ask for price
    • Product line: Cell Surface Molecules / GPCRs
    • Brand:
Rat Poliovirus Receptor (PVR) Protein
  • EUR 746.00
  • EUR 300.00
  • EUR 2346.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Poliovirus Receptor (PVR) Antibody (FITC)
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
PVR Poliovirus Receptor Human Recombinant Protein
PROTP15151 Regular: 5ug
EUR 317
Description: PVR Human Recombinant produced in Sf9 Insect cells is a single, glycosylated polypeptide chain containing 331 amino acids (21-343 a.a.) and having a molecular mass of 36.1kDa (Molecular size on SDS-PAGE will appear at approximately 40-57kDa). PVR is expressed with an 8 amino acids His tag at C-Terminus and purified by proprietary chromatographic techniques. 
Poliovirus Receptor (PVR) Polyclonal Antibody (Rat)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Leu22~Ile255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR)
Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse)
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Met56~Thr309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR)
Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Leu22~Ile255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with APC.
Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Leu22~Ile255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with Biotin.
Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Leu22~Ile255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with Cy3.
Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Leu22~Ile255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with FITC.
Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Leu22~Ile255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with HRP.
Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Leu22~Ile255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with PE.
Recombinant Human Poliovirus Receptor/PVR/CD155 (C-6His)
C622-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Recombinant Human Poliovirus Receptor/PVR/CD155 (C-6His)
C622-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Recombinant Human Poliovirus Receptor/PVR/CD155 (C-6His)
C622-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Recombinant Human Poliovirus Receptor/PVR/CD155 (C-6His)
C622-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Met56~Thr309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with APC.
Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), Biotinylated
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Met56~Thr309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with Biotin.
Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Met56~Thr309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with Cy3.
Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Met56~Thr309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with FITC.
Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Met56~Thr309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with HRP.
Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Met56~Thr309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with PE.
Poliovirus Receptor (PVR) Polyclonal Antibody (Human, Mouse), APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Met56~Thr309)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Poliovirus Receptor (PVR). This antibody is labeled with APC-Cy7.
Poliovirus Receptor (PVR) Polyclonal Antibody (Rat), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PVR (Leu22~Ile255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Poliovirus Receptor (PVR). This antibody is labeled with APC-Cy7.
anti-Poliovirus receptor
YF-PA14226 100 ug
EUR 403
Description: Rabbit polyclonal to Poliovirus receptor
anti-Poliovirus receptor
YF-PA24528 50 ul
EUR 334
Description: Mouse polyclonal to Poliovirus receptor
PVR ELISA Kit (Human) (OKCD00114)
OKCD00114 96 Wells
EUR 792
Description: Description of target: Mediates NK cell adhesion and triggers NK cell effector functions. Binds two different NK cell receptors: CD96 and CD226. These interactions accumulates at the cell-cell contact site, leading to the formation of a mature immunological synapse between NK cell and target cell. This may trigger adhesion and secretion of lytic granules and IFN-gamma and activate cytoxicity of activated NK cells. May also promote NK cell-target cell modular exchange, and PVR transfer to the NK cell. This transfer is more important in some tumor cells expressing a lot of PVR, and may trigger fratricide NK cell activation, providing tumors with a mechanism of immunoevasion. Plays a role in mediating tumor cell invasion and migration.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.17"CD155/PVR plays a key role in cell motility during tumor cell invasion and migration."_x005F_x005F_x000D_Sloan K.E., Eustace B.K., Stewart J.K., Zehetmeier C., Torella C., Simeone M., Roy J.E., Unger C., Louis D.N., Ilag L.L., Jay D.G._x005F_x005F_x000D_BMC Cancer 4:73-73(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.21"PVR (CD155) and Nectin-2 (CD112) as ligands of the human DNAM-1 (CD226) activating receptor: involvement in tumor cell lysis."_x005F_x005F_x000D_Pende D., Bottino C., Castriconi R., Cantoni C., Marcenaro S., Rivera P., Spaggiari G.M., Dondero A., Carnemolla B., Reymond N., Mingari M.C., Lopez M., Moretta L., Moretta A._x005F_x005F_x000D_Mol. Immunol. 42:463-469(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION. (Microbial infection) Acts as a receptor for poliovirus. May play a role in axonal transport of poliovirus, by targeting virion-PVR-containing endocytic vesicles to the microtubular network through interaction with DYNLT1. This interaction would drive the virus-containing vesicle to the axonal retrograde transport (PubMed:2538245). Acts as a receptor for pseudorabies virus (PubMed:9616127). Is prevented to reach cell surface upon infection by human cytomegalovirus /HHV-5, presumably to escape immune recognition of infected cell by NK cells (PubMed:15640804).3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Cellular receptor for poliovirus: molecular cloning, nucleotide sequence, and expression of a new member of the immunoglobulin superfamily."_x005F_x005F_x000D_Mendelsohn C.L., Wimmer E., Racaniello V.R._x005F_x005F_x000D_Cell 56:855-865(1989) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA], FUNCTION (MICROBIAL INFECTION), INTERACTION WITH POLIOVIRUS CAPSID PROTEINS.Ref.9"Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor."_x005F_x005F_x000D_Geraghty R.J., Krummenacher C., Cohen G.H., Eisenberg R.J., Spear P.G._x005F_x005F_x000D_Science 280:1618-1620(1998) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION (MICROBIAL INFECTION), INTERACTION WITH PSEUDORAVIES VIRUS GD PROTEIN.Ref.22"Downregulation of natural killer cell-activating ligand CD155 by human cytomegalovirus UL141."_x005F_x005F_x000D_Tomasec P., Wang E.C., Davison A.J., Vojtesek B., Armstrong M., Griffin C., McSharry B.P., Morris R.J., Llewellyn-Lacey S., Rickards C., Nomoto A., Sinzger C., Wilkinson G.W._x005F_x005F_x000D_Nat. Immunol. 6:181-188(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION (MICROBIAL INFECTION), INTERACTION WITH HHV-5 UL141. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.0 pg/mL
PVR ELISA Kit (Human) (OKBB01249)
OKBB01249 96 Wells
EUR 505
Description: Description of target: CD155 (cluster of differentiation 155) also known as the poliovirus receptor is a protein that in humans is encoded by the PVR gene. It is mapped to 19q13.31. The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml
PVR ELISA Kit (Human) (OKEH08313)
OKEH08313 96 Wells
EUR 896
Description: Description of target: The protein encoded by this gene is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. The external domain mediates cell attachment to the extracellular matrix molecule vitronectin, while its intracellular domain interacts with the dynein light chain Tctex-1/DYNLT1. The gene is specific to the primate lineage, and serves as a cellular receptor for poliovirus in the first step of poliovirus replication. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063ng/mL
Human PVRL1/ Poliovirus receptor-related protein 1 ELISA Kit
E2100Hu 1 Kit
EUR 571
Human PVRL1(Poliovirus receptor-related protein 1) ELISA Kit
EH1893 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q15223
  • Alias: PVRL1/Poliovirus receptor-related protein 1/Nectin-1/Herpes virus entry mediator C/Herpesvirus entry mediator C/HveC/Herpesvirus Ig-like receptor/HIgR/HVEC/PRR1/CD111/PVRR1/SK-12
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Poliovirus receptor- related protein 4, PVRL4 ELISA KIT
ELI-14050h 96 Tests
EUR 824
Human Poliovirus receptor- related protein 1, PVRL1 ELISA KIT
ELI-05552h 96 Tests
EUR 824
Human Poliovirus receptor- related protein 2, PVRL2 ELISA KIT
ELI-45481h 96 Tests
EUR 824
Human Poliovirus receptor- related protein 3, PVRL3 ELISA KIT
ELI-30533h 96 Tests
EUR 824
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
DLR-PVRL1-Hu-48T 48T
EUR 498
  • Should the Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
DLR-PVRL1-Hu-96T 96T
EUR 647
  • Should the Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
DLR-PVRL4-Hu-48T 48T
EUR 517
  • Should the Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
DLR-PVRL4-Hu-96T 96T
EUR 673
  • Should the Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
SEB470Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 1 (PVRL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
SEB470Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 1 (PVRL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
SEB470Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 1 (PVRL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
SEB470Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 1 (PVRL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in Tissue homogenates, cell lysates and other biological fluids.
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Poliovirus Receptor Related Protein 1 elisa. Alternative names of the recognized antigen: CD111
  • HVEC
  • PRR1
  • CLPED1
  • ED4
  • HIgR
  • OFC7
  • PRR
  • PVRR1
  • SK12
  • Nectin 1
  • Herpesvirus Entry Mediator C
  • Herpesvirus Ig-like receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Poliovirus Receptor Related Protein 1 (PVRL1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
SEC757Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 4 (PVRL4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
SEC757Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 4 (PVRL4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
SEC757Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 4 (PVRL4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
SEC757Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Poliovirus Receptor Related Protein 4 (PVRL4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Poliovirus Receptor Related Protein 4 elisa. Alternative names of the recognized antigen: PRR4
  • LNIR
  • Nectin-4
  • Ig superfamily receptor LNIR
  • Processed poliovirus receptor-related protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Poliovirus Receptor Related Protein 4 (PVRL4) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Poliovirus Receptor Related Protein 1 ELISA Kit (PVRL1)
RK02171 96 Tests
EUR 521
Human Poliovirus Receptor Related Protein 4 ELISA Kit (PVRL4)
RK02172 96 Tests
EUR 521
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
RD-PVRL1-Hu-48Tests 48 Tests
EUR 500
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
RD-PVRL1-Hu-96Tests 96 Tests
EUR 692
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
RD-PVRL4-Hu-48Tests 48 Tests
EUR 521
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
RD-PVRL4-Hu-96Tests 96 Tests
EUR 723
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
RDR-PVRL1-Hu-48Tests 48 Tests
EUR 522
Human Poliovirus Receptor Related Protein 1 (PVRL1) ELISA Kit
RDR-PVRL1-Hu-96Tests 96 Tests
EUR 724
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
RDR-PVRL4-Hu-48Tests 48 Tests
EUR 544
Human Poliovirus Receptor Related Protein 4 (PVRL4) ELISA Kit
RDR-PVRL4-Hu-96Tests 96 Tests
EUR 756
Human Poliovirus Receptor Related Protein 4(PVRL4)ELISA Kit
QY-E02930 96T
EUR 361
Human CD155/PVR PicoKine ELISA Kit
EK1831 96 wells
EUR 425
Description: For quantitative detection of human CD155/PVR in cell culture supernates, serum and plasma (heparin, EDTA).
Recombinant (HEK) HUman Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, his-tag, >95%)
PVR18-R-25 25 ug
EUR 286
Human Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx571614-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
ELISA kit for Human PVRL4 (Poliovirus Receptor Related Protein 4)
ELK2960 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Poliovirus Receptor Related Protein 4 (PVRL4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody
  • Show more
Description: A sandwich ELISA kit for detection of Poliovirus Receptor Related Protein 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human PVRL1 (Poliovirus Receptor Related Protein 1)
ELK4424 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Poliovirus Receptor Related Protein 1 (PVRL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody
  • Show more
Description: A sandwich ELISA kit for detection of Poliovirus Receptor Related Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Poliovirus Receptor Related Protein 4 / PVRL4 (NECTIN4) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Poliovirus Receptor Related Immunoglobulin Domain Containing (PVRIG) ELISA Kit
abx382582-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx251210-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
ELISA kit for Human Poliovirus receptor-related protein 4 (PVRL4)
KTE61033-48T 48T
EUR 332
  • Poliovirus receptor-like proteins (PVRLs), such as PVRL4, are adhesion receptors of the immunoglobulin superfamily and function in cell-cell adhesion (Reymond et al., 2001). By database analysis, Reymond et al. (2001) identified the PVRL4 gene, which
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 4 (PVRL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Poliovirus receptor-related protein 4 (PVRL4)
KTE61033-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Poliovirus receptor-like proteins (PVRLs), such as PVRL4, are adhesion receptors of the immunoglobulin superfamily and function in cell-cell adhesion (Reymond et al., 2001). By database analysis, Reymond et al. (2001) identified the PVRL4 gene, which
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 4 (PVRL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Poliovirus receptor-related protein 4 (PVRL4)
KTE61033-96T 96T
EUR 539
  • Poliovirus receptor-like proteins (PVRLs), such as PVRL4, are adhesion receptors of the immunoglobulin superfamily and function in cell-cell adhesion (Reymond et al., 2001). By database analysis, Reymond et al. (2001) identified the PVRL4 gene, which
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 4 (PVRL4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Poliovirus receptor-related protein 1 (PVRL1)
KTE61034-48T 48T
EUR 332
  • PVRL1, or nectin-1, belongs to the nectin subfamily of immunoglobulin-like adhesion molecules that participate in Ca(2+)-independent cell-cell adhesion. Nectins bind to the actin cytoskeleton through the adaptor protein afadin (MLLT4) and are key com
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 1 (PVRL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Poliovirus receptor-related protein 1 (PVRL1)
KTE61034-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PVRL1, or nectin-1, belongs to the nectin subfamily of immunoglobulin-like adhesion molecules that participate in Ca(2+)-independent cell-cell adhesion. Nectins bind to the actin cytoskeleton through the adaptor protein afadin (MLLT4) and are key com
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 1 (PVRL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Poliovirus receptor-related protein 1 (PVRL1)
KTE61034-96T 96T
EUR 539
  • PVRL1, or nectin-1, belongs to the nectin subfamily of immunoglobulin-like adhesion molecules that participate in Ca(2+)-independent cell-cell adhesion. Nectins bind to the actin cytoskeleton through the adaptor protein afadin (MLLT4) and are key com
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Poliovirus receptor-related protein 1 (PVRL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Poliovirus Receptor-Related 3 Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
ELISA kit for Mouse Poliovirus receptor-related protein 1
EK3896 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Poliovirus receptor-related protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Mouse Pvrl1/ Poliovirus receptor-related protein 1 ELISA Kit
E1233Mo 1 Kit
EUR 571
Mouse Poliovirus receptor- related protein 1, Pvrl1 ELISA KIT
ELI-05550m 96 Tests
EUR 865
Porcine Poliovirus receptor- related protein 1, PVRL1 ELISA KIT
ELI-05551p 96 Tests
EUR 928
Mouse Poliovirus receptor- related protein 2, Pvrl2 ELISA KIT
ELI-16765m 96 Tests
EUR 865
Bovine Poliovirus receptor- related protein 4, PVRL4 ELISA KIT
ELI-16766b 96 Tests
EUR 928
Mouse Poliovirus receptor- related protein 3, Pvrl3 ELISA KIT
ELI-42932m 96 Tests
EUR 865
Mouse Poliovirus receptor- related protein 4, Pvrl4 ELISA KIT
ELI-44453m 96 Tests
EUR 865
Mouse PVRL1( Poliovirus receptor-related protein 1) ELISA Kit
EM0670 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9JKF6
  • Alias: PVRL1/CD111/HVEC/PRR1/PVRR1/CD111/CD111 antigen/CLPED1ectodermal dysplasia 4(Margarita Island type)/ED4/Herpes virus entry mediator C/Herpesvirus entry mediator C/Herpesvirus Ig-like receptor/
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml
Mouse PVRL2(Poliovirus Receptor Related Protein 2) ELISA Kit
EM1323 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P32507
  • Alias: PVRL2/Poliovirus Receptor Related Protein 2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml
Recombinant (HEK) Human Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, hIgG1-Fc-his, >95%)
PVR17-R-25 25 ug
EUR 286
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Human Poliovirus receptor-related protein 4 (NECTIN4)
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 36.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Poliovirus receptor-related protein 4(NECTIN4),partial expressed in Yeast
Recombinant (HEK) Mouse Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, his-tag, >95%)
PVR16-R-25 25 ug
EUR 286
Recombinant (HEK) Mouse Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, His-tag, >95%)
PVR16-R-50 50 ug
EUR 469
Human Poliovirus Receptor Related Protein 4 (PVRL4) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Poliovirus Receptor Related Protein 1 (PVRL1) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PVR Antibody
33018-100ul 100ul
EUR 252
PVR Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PVR. Recognizes PVR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
PVR Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PVR. Recognizes PVR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
PVR Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PVR. Recognizes PVR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
PVR Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PVR. Recognizes PVR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Pig Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx518213-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
ELISA kit for Mouse PVRL1 (Poliovirus Receptor Related Protein 1)
E-EL-M0934 1 plate of 96 wells
EUR 534
  • Gentaur's PVRL1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse PVRL1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse PVRL1 (Poliovirus Receptor Related Protein 1) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Mouse PVRL2 (Poliovirus Receptor Related Protein 2)
E-EL-M0935 1 plate of 96 wells
EUR 534
  • Gentaur's PVRL2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse PVRL2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse PVRL2 (Poliovirus Receptor Related Protein 2) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Mouse PVRL3 (Poliovirus Receptor Related Protein 3)
E-EL-M0936 1 plate of 96 wells
EUR 534
  • Gentaur's PVRL3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse PVRL3. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse PVRL3 (Poliovirus Receptor Related Protein 3) in samples from Serum, Plasma, Cell supernatant
PVRL1 ELISA Kit| Mouse Poliovirus receptor-related protein 1 EL
EF013285 96 Tests
EUR 689
PVRL2 ELISA Kit| Mouse Poliovirus Receptor Related Protein 2 ELI
EF013858 96 Tests
EUR 689
Mouse Poliovirus Receptor Related Protein 3 / PVRL3 (NECTIN3) ELISA Kit
abx352972-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Rat Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx353854-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Rat Poliovirus Receptor Related Protein 2 / PVRL2 (NECTIN2) ELISA Kit
abx353855-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
Mouse Poliovirus Receptor Related Protein 1 / PVRL1 (NECTIN1) ELISA Kit
abx255020-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Mouse Poliovirus Receptor Related Protein 2 / PVRL2 (NECTIN2) ELISA Kit
abx254380-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
ELISA kit for Rat PVRL1 (Poliovirus Receptor Related Protein 1)
E-EL-R0765 1 plate of 96 wells
EUR 534
  • Gentaur's PVRL1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PVRL1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PVRL1 (Poliovirus Receptor Related Protein 1) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Rat PVRL2 (Poliovirus Receptor Related Protein 2)
E-EL-R0766 1 plate of 96 wells
EUR 534
  • Gentaur's PVRL2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat PVRL2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat PVRL2 (Poliovirus Receptor Related Protein 2) in samples from Serum, Plasma, Cell supernatant
Recombinant (HEK) Mouse Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, hIgG1-Fc-his, >95%)
PVR15-R-25 25 ug
EUR 286
Recombinant (HEK) Mouse Poliovirus receptor (PVR or CD155 or Necl-5) protein (1-345aa, hIgG1-Fc-His, >95%)
PVR15-R-50 50 ug
EUR 469
Human PVR shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PVR Recombinant Protein (Human)
RP025297 100 ug Ask for price
Human Poliovirus Receptor Related Protein 1 (PVRL1) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Human Poliovirus Receptor Related Protein 2 (PVRL2) Protein
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Poliovirus Receptor Related Protein 3 (PVRL3) Protein
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Poliovirus Receptor Related Protein 4 (PVRL4) Protein
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Poliovirus Receptor Related Protein 1 (PVRL1) Antibody
abx117183-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.
Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
abx122022-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Poliovirus receptor-related 1 (PVRL1) polyclonal antibody
ABP-PAB-11266 100 ug Ask for price
    • Product line: Cell Surface Molecules / GPCRs
    • Brand:
Poliovirus Receptor Related Protein 1 (PVRL1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Poliovirus Receptor Related Protein 3 (PVRL3) Antibody
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Poliovirus Receptor Related Protein 3 (PVRL3) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Poliovirus Receptor Related Protein 3 (PVRL3) Antibody
abx027068-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Poliovirus Receptor Related Protein 3 (PVRL3) Antibody
abx027068-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
abx029867-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
abx029867-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Poliovirus Receptor Related Protein 1 (PVRL1) Antibody
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Poliovirus Receptor Related Protein 1 (PVRL1) Antibody
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.
Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
abx340224-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Poliovirus Receptor Related Protein 2 (PVRL2) Antibody
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-7 working days.
Poliovirus Receptor Related Protein 4 (PVRL4) Antibody
abx236962-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Recombinant Poliovirus Receptor Related Protein 4 (PVRL4)
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q96NY8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Poliovirus Receptor Related Protein 4 expressed in: E.coli
Recombinant Poliovirus Receptor Related Protein 2 (PVRL2)
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92692
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.8kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Poliovirus Receptor Related Protein 2 expressed in: E.coli
Recombinant Poliovirus Receptor Related Protein 2 (PVRL2)
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P32507
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.8kDa
  • Isoelectric Point: 5.8
Description: Recombinant Mouse Poliovirus Receptor Related Protein 2 expressed in: E.coli
Recombinant Poliovirus Receptor Related Protein 3 (PVRL3)
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NQS3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.6kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Poliovirus Receptor Related Protein 3 expressed in: E.coli
Recombinant Poliovirus Receptor Related Protein 3 (PVRL3)
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9JLB9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.1kDa
  • Isoelectric Point: 7.8
Description: Recombinant Mouse Poliovirus Receptor Related Protein 3 expressed in: E.coli
PVR Conjugated Antibody
C33018 100ul
EUR 397
PVR cloning plasmid
CSB-CL019093HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atggcccgagccatggccgccgcgtggccgctgctgctggtggcgctactggtgctgtcctggccacccccaggaaccggggacgtcgtcgtgcaggcgcccacccaggtgcccggcttcttgggcgactccgtgacgctgccctgctacctacaggtgcccaacatggaggtga
  • Show more
Description: A cloning plasmid for the PVR gene.
PVR Rabbit pAb
A11824-100ul 100 ul
EUR 308
PVR Rabbit pAb
A11824-200ul 200 ul
EUR 459
PVR Rabbit pAb
A11824-20ul 20 ul Ask for price
PVR Rabbit pAb
A11824-50ul 50 ul Ask for price
PVR Rabbit pAb
A5753-100ul 100 ul
EUR 308
PVR Rabbit pAb
A5753-200ul 200 ul
EUR 459
PVR Rabbit pAb
A5753-20ul 20 ul
EUR 183
PVR Rabbit pAb
A5753-50ul 50 ul
EUR 223

Human PVR(Poliovirus Receptor) ELISA Kit