Human SDC3(Syndecan 3) ELISA Kit
Human Syndecan 3 (SDC3) ELISA Kit |
RD-SDC3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Syndecan 3 (SDC3) ELISA Kit |
RDR-SDC3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Syndecan 3 (SDC3) ELISA Kit |
RDR-SDC3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Syndecan 3(SDC3) ELISA kit |
E01S0351-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Syndecan 3(SDC3) ELISA kit |
E01S0351-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Syndecan 3(SDC3) ELISA kit |
E01S0351-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human SDC3(Syndecan 3) ELISA Kit |
EH3753 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.625-40 ng/ml
- Uniprot ID: O75056
- Alias: SDC3/N-Syndecan/KIAA0468/N-syndecan/SDCN/SYND3syndecan proteoglycan 3/syndecan 3/syndecan 3(N-syndecan)/syndecan neural type/syndecan-3
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml |
Human Syndecan 3 (SDC3) ELISA Kit |
20-abx153206 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Syndecan 3 (SDC3) ELISA Kit |
abx253142-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Syndecan-3(SDC3)ELISA Kit |
CSB-E14984h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-3 (SDC3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Syndecan-3(SDC3)ELISA Kit |
1-CSB-E14984h |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-3(SDC3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Syndecan 3 (SDC3) ELISA Kit |
SED172Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 3 (SDC3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 3 (SDC3) in Tissue homogenates and other biological fluids. |
Human Syndecan 3 (SDC3) ELISA Kit |
SED172Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 3 (SDC3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 3 (SDC3) in Tissue homogenates and other biological fluids. |
Human Syndecan 3 (SDC3) ELISA Kit |
SED172Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 3 (SDC3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 3 (SDC3) in Tissue homogenates and other biological fluids. |
Human Syndecan 3 (SDC3) ELISA Kit |
SED172Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 3 (SDC3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 3 (SDC3) in Tissue homogenates and other biological fluids. |
Human Syndecan 3 (SDC3) ELISA Kit |
4-SED172Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Syndecan 3 elisa. Alternative names of the recognized antigen: SDCN
- SYND3
- N-Syndecan
- Syndecan Proteoglycan 3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syndecan 3 (SDC3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Pig Syndecan 3 (SDC3) ELISA Kit |
abx361300-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Syndecan 3 (SDC3) ELISA Kit |
abx363411-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Syndecan 3(SDC3) ELISA kit |
E03S0351-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Syndecan 3(SDC3) ELISA kit |
E03S0351-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Syndecan 3(SDC3) ELISA kit |
E03S0351-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Syndecan 3(SDC3) ELISA kit |
E02S0351-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Syndecan 3(SDC3) ELISA kit |
E02S0351-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Syndecan 3(SDC3) ELISA kit |
E02S0351-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Syndecan 3(SDC3) ELISA kit |
E04S0351-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Syndecan 3(SDC3) ELISA kit |
E04S0351-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Syndecan 3(SDC3) ELISA kit |
E04S0351-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Syndecan 3(SDC3) ELISA kit |
E06S0351-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Syndecan 3(SDC3) ELISA kit |
E06S0351-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Syndecan 3(SDC3) ELISA kit |
E06S0351-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Syndecan 3(SDC3) ELISA kit |
E08S0351-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Syndecan 3(SDC3) ELISA kit |
E08S0351-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Syndecan 3(SDC3) ELISA kit |
E08S0351-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Syndecan 3(SDC3) ELISA kit |
E07S0351-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Syndecan 3(SDC3) ELISA kit |
E07S0351-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Syndecan 3(SDC3) ELISA kit |
E07S0351-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Syndecan 3(SDC3) ELISA kit |
E09S0351-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Syndecan 3(SDC3) ELISA kit |
E09S0351-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Syndecan 3(SDC3) ELISA kit |
E09S0351-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Chicken Syndecan 3 (SDC3) ELISA Kit |
abx356132-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Syndecan 3 (SDC3) ELISA Kit |
abx359497-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Syndecan-3(SDC3) ELISA kit |
CSB-EL020890MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Syndecan-3 (SDC3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Syndecan-3(SDC3) ELISA kit |
1-CSB-EL020890MO |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Syndecan-3(SDC3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Syndecan-3/SDC3 PicoKine ELISA Kit |
EK1555 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Syndecan-3 in cell culture supernates , cell lysates, serum and plasma(heparin, EDTA). |
ELISA kit for Human Syndecan-3/SDC3 |
EK5737 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Syndecan-3/SDC3 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human SDC3 (Syndecan 3) |
ELK3691 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syndecan 3 (SDC3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syndecan 3 (SDC3
- Show more
|
Description: A sandwich ELISA kit for detection of Syndecan 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human SDC3 (Syndecan 3) |
E-EL-H1261 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's SDC3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SDC3. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human SDC3 (Syndecan 3) in samples from Serum, Plasma, Cell supernatant |
Syndecan 3 (SDC3) Antibody |
20-abx115958 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Syndecan 3 (SDC3) Antibody |
20-abx174697 |
Abbexa |
|
|
|
Syndecan 3 (SDC3) Antibody |
20-abx214134 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Syndecan-3 (SDC3) Antibody |
abx238435-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Syndecan 3 (SDC3) Antibody |
20-abx241466 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Syndecan 3 (SDC3) Antibody |
20-abx178523 |
Abbexa |
|
|
|
Human Syndecan 3 (SDC3) CLIA Kit |
abx196253-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Syndecan 3 (SDC3) CLIA Kit |
20-abx494120 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Syndecan 3 (SDC3) Protein |
20-abx655180 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Guinea pig Syndecan 3(SDC3) ELISA kit |
E05S0351-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Syndecan 3(SDC3) ELISA kit |
E05S0351-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Syndecan 3(SDC3) ELISA kit |
E05S0351-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Syndecan-3/SDC3 PicoKine ELISA Kit |
EK1556 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse Syndecan-3 in cell culture supernates , cell lysates, serum and plasma(heparin, EDTA). |
ELISA kit for Mouse Syndecan-3/SDC3 |
EK5738 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Syndecan-3/SDC3 in samples from serum, plasma, tissue homogenates and other biological fluids. |
CLIA kit for Human SDC3 (Syndecan 3) |
E-CL-H0818 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's SDC3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human SDC3 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human SDC3 (Syndecan 3) in samples from Serum, Plasma, Cell supernatant |
Anti-Syndecan 3/SDC3 Antibody |
PA2133 |
BosterBio |
100ug/vial |
EUR 334 |
ELISA kit for Human Syndecan-1 (SDC3) |
KTE60727-48T |
Abbkine |
48T |
EUR 354 |
- By screening a human fetal brain cDNA library with a fragment of the ectodomain of human SDC3, followed by ligation of overlapping clones, Berndt et al. (2001) obtained a full-length SDC3 cDNA. The deduced 443-amino acid protein contains a large extr
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Syndecan-1 (SDC3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Syndecan-1 (SDC3) |
KTE60727-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- By screening a human fetal brain cDNA library with a fragment of the ectodomain of human SDC3, followed by ligation of overlapping clones, Berndt et al. (2001) obtained a full-length SDC3 cDNA. The deduced 443-amino acid protein contains a large extr
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Syndecan-1 (SDC3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Syndecan-1 (SDC3) |
KTE60727-96T |
Abbkine |
96T |
EUR 572 |
- By screening a human fetal brain cDNA library with a fragment of the ectodomain of human SDC3, followed by ligation of overlapping clones, Berndt et al. (2001) obtained a full-length SDC3 cDNA. The deduced 443-amino acid protein contains a large extr
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Syndecan-1 (SDC3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
SDC3 ELISA Kit (Human) (OKCD01742) |
OKCD01742 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Cell surface proteoglycan that may bear heparan sulfate. May have a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.226 ng/mL |
SDC3 ELISA Kit (Human) (OKBB01081) |
OKBB01081 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Syndecan-3 is a protein that in humans is encoded by the SDC3 gene. The protein encoded by this gene belongs to the syndecan proteoglycan family, which was assigned to human chromosome 1p35.2, and it showed that in the mouse the Synd3 gene maps to chromosome 4 near the Lmyc gene. The transfection of SDC3 resulted in the formation of long filopodia-like structures, microspikes, and varicosities in several cell lines. Besides, the gene plays a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism. Allelic variants of this gene have been associated with obesity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
SDC3 ELISA Kit (Human) (OKCA02150) |
OKCA02150 |
Aviva Systems Biology |
96 Wells |
EUR 917 |
Description: Description of target: Cell surface proteoglycan that may bear heparan sulfate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.72 pg/mL |
Sdc3 ELISA Kit (Mouse) (OKBB01082) |
OKBB01082 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Syndecan-3 is a protein that in humans is encoded by the SDC3 gene. The protein encoded by this gene belongs to the syndecan proteoglycan family, which was assigned to human chromosome 1p35.2, and it showed that in the mouse the Synd3 gene maps to chromosome 4 near the Lmyc gene. The transfection of SDC3 resulted in the formation of long filopodia-like structures, microspikes, and varicosities in several cell lines. Besides, the gene plays a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism. Allelic variants of this gene have been associated with obesity.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
SDC3 ELISA Kit (Mouse) (OKCA00929) |
OKCA00929 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Cell surface proteoglycan that may bear heparan sulfate. May have a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL |
Human Syndecan 4 ELISA kit |
E01S0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Syndecan 4 ELISA kit |
E01S0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Syndecan 4 ELISA kit |
E01S0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
SDC3 siRNA |
20-abx904823 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sdc3 antibody |
70R-8670 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Sdc3 antibody |
SDC3 Antibody |
40231-100ul |
SAB |
100ul |
EUR 252 |
SDC3 antibody |
70R-20126 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal SDC3 antibody |
SDC3 siRNA |
20-abx932694 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SDC3 siRNA |
20-abx932695 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SDC3 Antibody |
1-CSB-PA925237 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SDC3. Recognizes SDC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
SDC3 Antibody |
1-CSB-PA296842 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SDC3. Recognizes SDC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:40-1:150 |
SDC3 Antibody |
1-CSB-PA020890GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against SDC3. Recognizes SDC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF |
Syndecan-3 Antibody |
3824-100 |
Biovision |
|
EUR 354 |
Syndecan-3 Antibody |
3824-30T |
Biovision |
|
EUR 146 |
Syndecan 3 antibody |
20R-1738 |
Fitzgerald |
100 ug |
EUR 673 |
Description: Rabbit polyclonal Syndecan 3 antibody |
Syndecan 3 antibody |
70R-12120 |
Fitzgerald |
100 ug |
EUR 460 |
Description: Rabbit polyclonal Syndecan 3 antibody |
Syndecan-3 Antibody |
DF12329 |
Affbiotech |
200ul |
EUR 304 |
Description: Syndecan-3 antibody detects endogenous levels of Syndecan-3. |
Human Syndecan-1 (SDC1) ELISA Kit |
abx570426-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Syndecan 1 (SDC1) ELISA Kit |
20-abx585066 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Syndecan 1/CD138 ELISA kit |
E01S0301-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Syndecan 1/CD138 ELISA kit |
E01S0301-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Syndecan 1/CD138 ELISA kit |
E01S0301-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human Syndecan-1 |
EK4130 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Syndecan-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Syndecan-2 |
EK4472 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Syndecan-2 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human SDC1/ Syndecan-1 ELISA Kit |
E2224Hu |
Sunlong |
1 Kit |
EUR 571 |
Human SDC2/ Syndecan-2 ELISA Kit |
E2225Hu |
Sunlong |
1 Kit |
EUR 571 |
Syndecan-1 (SDC1) (Human) ELISA Kit |
E4354-100 |
Biovision |
|
EUR 805 |
Human SDC1(Syndecan-1) ELISA Kit |
EH0278 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P18827
- Alias: Syndecan‑1/SDC1/CD138/SDC/syndecan/syndecan 1/syndecan proteoglycan 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human SDC4(Syndecan 4) ELISA Kit |
EH3754 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 1.563-100 ng/ml
- Uniprot ID: P31431
- Alias: SDC4/Amphiglycan/Ryudocan/amphiglycan/Amphiglycan/MGC22217/ryudocan/Ryudocan core protein/SYND4ryudocan amphiglycan/syndecan 4/syndecan 4(amphiglycan, ryudocan)/syndecan proteoglycan 4/syndec
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml |
Human Syndecan 1 (SDC1) ELISA Kit |
20-abx153205 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Syndecan 4 (SDC4) ELISA Kit |
20-abx153207 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Syndecan-2 (SDC2) ELISA Kit |
abx251539-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Syndecan 1 (SDC1) ELISA Kit |
abx252159-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Syndecan 4 (SDC4) ELISA Kit |
abx253143-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Syndecan 1 (SDC1) ELISA Kit |
DLR-SDC1-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Syndecan 1 (SDC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Syndecan 1 (SDC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Syndecan 1 (SDC1) ELISA Kit |
DLR-SDC1-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Syndecan 1 (SDC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Syndecan 1 (SDC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Syndecan 4 (SDC4) ELISA Kit |
DLR-SDC4-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Syndecan 4 (SDC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Syndecan 4 (SDC4) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Syndecan 4 (SDC4) ELISA Kit |
DLR-SDC4-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Syndecan 4 (SDC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Syndecan 4 (SDC4) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Syndecan-2(SDC2) ELISA kit |
CSB-EL020889HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-2 (SDC2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Syndecan-2(SDC2) ELISA kit |
1-CSB-EL020889HU |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-2(SDC2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human syndecan 4 (SDC4) ELISA kit |
CSB-EL020891HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human syndecan 4 (SDC4) in samples from serum, plasma, cell lysates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human syndecan 4 (SDC4) ELISA kit |
1-CSB-EL020891HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human syndecan 4 (SDC4) in samples from serum, plasma, cell lysates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Syndecan 4 (SDC4) ELISA Kit |
SEB939Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 4 (SDC4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 4 (SDC4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Syndecan 4 (SDC4) ELISA Kit |
SEB939Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 4 (SDC4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 4 (SDC4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Syndecan 4 (SDC4) ELISA Kit |
SEB939Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 4 (SDC4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 4 (SDC4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Syndecan 4 (SDC4) ELISA Kit |
SEB939Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 4 (SDC4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 4 (SDC4) in serum, plasma, tissue homogenates and other biological fluids. |
Human Syndecan 4 (SDC4) ELISA Kit |
4-SEB939Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Syndecan 4 elisa. Alternative names of the recognized antigen: SYND4
- Amphiglycan
- Ryudocan
- Ryudocan core protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syndecan 4 (SDC4) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Syndecan 1 (SDC1) ELISA Kit |
SEB966Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 1 (SDC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 1 (SDC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Syndecan 1 (SDC1) ELISA Kit |
SEB966Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 1 (SDC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 1 (SDC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Syndecan 1 (SDC1) ELISA Kit |
SEB966Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 1 (SDC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 1 (SDC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Syndecan 1 (SDC1) ELISA Kit |
SEB966Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 1 (SDC1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 1 (SDC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Syndecan 1 (SDC1) ELISA Kit |
4-SEB966Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Syndecan 1 elisa. Alternative names of the recognized antigen: CD138
- SDC
- SYND1
- Syndecan Proteoglycan 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syndecan 1 (SDC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Syndecan 1 ELISA Kit (SDC1) |
RK02253 |
Abclonal |
96 Tests |
EUR 521 |
Human Syndecan 4 ELISA Kit (SDC4) |
RK02254 |
Abclonal |
96 Tests |
EUR 521 |
Human Syndecan 1 (SDC1) ELISA Kit |
RD-SDC1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Syndecan 1 (SDC1) ELISA Kit |
RD-SDC1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Syndecan 4 (SDC4) ELISA Kit |
RD-SDC4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Syndecan 4 (SDC4) ELISA Kit |
RD-SDC4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Syndecan 1 (SDC1) ELISA Kit |
RDR-SDC1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Syndecan 1 (SDC1) ELISA Kit |
RDR-SDC1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Syndecan 4 (SDC4) ELISA Kit |
RDR-SDC4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Syndecan 4 (SDC4) ELISA Kit |
RDR-SDC4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human SDC3 shRNA Plasmid |
20-abx956446 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SDC3 Recombinant Protein (Human) |
RP027829 |
ABM |
100 ug |
Ask for price |
SDC3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2107604 |
ABM |
1.0 ug DNA |
EUR 154 |
Rat Syndecan 4 ELISA kit |
E02S0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Syndecan 4 ELISA kit |
E02S0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Syndecan 4 ELISA kit |
E02S0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Syndecan 4 ELISA kit |
E03S0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Syndecan 4 ELISA kit |
E03S0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Syndecan 4 ELISA kit |
E03S0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Syndecan 4 ELISA kit |
E04S0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Syndecan 4 ELISA kit |
E04S0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Syndecan 4 ELISA kit |
E04S0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Syndecan 4 ELISA kit |
E06S0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Syndecan 4 ELISA kit |
E06S0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Syndecan 4 ELISA kit |
E06S0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Syndecan 4 ELISA kit |
E07S0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Syndecan 4 ELISA kit |
E07S0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Syndecan 4 ELISA kit |
E07S0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Syndecan 4 ELISA kit |
E08S0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Syndecan 4 ELISA kit |
E08S0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Syndecan 4 ELISA kit |
E08S0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Syndecan 4 ELISA kit |
E09S0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Syndecan 4 ELISA kit |
E09S0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Syndecan 4 ELISA kit |
E09S0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
FSH (Human Follicle-stimulating hormone) ELISA test |
3 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Hormone testing
|
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone) |
ELISA kit for Human Syndecan-4/SDC4 |
EK5623 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Syndecan-4/SDC4 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human SDC1/Syndecan-1 PicoKine ELISA Kit |
EK1339 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Syndecan-1 in cell culture supernates and serum. |
Human Syndecan-4/SDC4 PicoKine ELISA Kit |
EK1356 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Syndecan-4 in cell culture supernates, serum and plasma(heparin, EDTA). |
ELISA kit for Human SDC4 (Syndecan 4) |
ELK2690 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syndecan 4 (SDC4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syndecan 4 (SDC4
- Show more
|
Description: A sandwich ELISA kit for detection of Syndecan 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human SDC1 (Syndecan 1) |
ELK2716 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syndecan 1 (SDC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syndecan 1 (SDC1
- Show more
|
Description: A sandwich ELISA kit for detection of Syndecan 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Syndecan-1/CD138(SDC1) ELISA Kit |
CSB-E14983h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-1/CD138 (SDC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Syndecan-1/CD138(SDC1) ELISA Kit |
1-CSB-E14983h |
Cusabio |
-
EUR 574.00
-
EUR 4013.00
-
EUR 2138.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-1/CD138(SDC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA kit for Human SDC1 (Syndecan 1) |
E-EL-H1298 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's SDC1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SDC1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human SDC1 (Syndecan 1) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human SDC4 (Syndecan 4) |
E-EL-H1682 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's SDC4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SDC4. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human SDC4 (Syndecan 4) in samples from Serum, Plasma, Cell supernatant |
Syndecan-4/SDC4 ELISA Kit (Human) (OKBB00392) |
OKBB00392 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Syndecan-4 (SDC4) is a protein that in humans is encoded by the SDC4 gene. The protein is found as a homodimer and is a member of the syndecan proteoglycan family. It is mapped to 20q13.12. Syndecan-4 is one of the four vertebrate syndecans and has a molecular weight of ~20 kDa. It is a transmembrane (type I) heparan sulfate proteoglycan that functions as a receptor in intracellular signaling. Syndecan-4 also regulates the actin cytoskeleton, cell adhesion, and cell migration. In addition, Syndecan-4 can activate protein kinase C (PKC). The variable domain of syndecan-4 could be a site of self-association. What’s more, Syndecan-4 also binds to phosphatidylinositol (4,5)-bisphosphate (PIP2) through the variable domain and increases PKC activity ten-fold.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL |
SDC1/Syndecan-1 ELISA Kit (Human) (OKBB00608) |
OKBB00608 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Syndecan 1, also known as SYND1 or CD138, is a protein which in humans is encoded by the SDC1 gene. The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. This gene is mapped to 2p24.1. The syndecans mediate cell binding, cell signaling, cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan 1 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. What’s more, Syndecan-1 is also a sponge for growth factors, with binding largely via heparan sulfate chains.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL |
Polyclonal Syndecan-3 Antibody |
AMM08059G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Syndecan-3 . This antibody is tested and proven to work in the following applications: |
anti- Syndecan-3 antibody |
FNab08435 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:500-1:2000
- IHC: 1:50-1:500
- IF: 1:50-1:500
- Immunogen: syndecan 3
- Uniprot ID: O75056
- Gene ID: 9672
- Research Area: Cardiovascular
|
Description: Antibody raised against Syndecan-3 |
Syndecan 3 Blocking Peptide |
33R-10555 |
Fitzgerald |
50 ug |
EUR 349 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Syndecan 3 antibody, catalog no. 20R-1738 |
Syndecan 3 Blocking Peptide |
33R-10937 |
Fitzgerald |
50 ug |
EUR 191 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Syndecan 3 antibody, catalog no. 70R-12120 |
Syndecan-3 Blocking Peptide |
3824BP-50 |
Biovision |
|
EUR 153 |
Syndecan-3 Blocking Peptide |
DF12329-BP |
Affbiotech |
1mg |
EUR 195 |
SDC3 Conjugated Antibody |
C40231 |
SAB |
100ul |
EUR 397 |
SDC3 cloning plasmid |
CSB-CL020890HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1113
- Sequence: atggccattgcttacctgggatcctcatgcccctcacaaccacccagctccctagctctctccctctcccccaccccctcagacttcgagcaggagtcgggcattgagacagccatgcgcttcagcccagatgtagccctggcggtgtccaccacaccatttgaagagctcccct
- Show more
|
Description: A cloning plasmid for the SDC3 gene. |
SDC3 Rabbit pAb |
A18312-100ul |
Abclonal |
100 ul |
EUR 308 |
SDC3 Rabbit pAb |
A18312-200ul |
Abclonal |
200 ul |
EUR 459 |
SDC3 Rabbit pAb |
A18312-20ul |
Abclonal |
20 ul |
EUR 183 |
SDC3 Rabbit pAb |
A18312-50ul |
Abclonal |
50 ul |
EUR 223 |
Sdc3 Blocking Peptide |
33R-3406 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Sdc3 antibody, catalog no. 70R-8670 |
Anti-SDC3 antibody |
STJ11100268 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the syndecan proteoglycan family. It may play a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism. Allelic variants of this gene have been associated with obesity. |
ELISA kit for Human Syndecan-2 (SDC2) Kit |
KTE60728-48T |
Abbkine |
48T |
EUR 354 |
Description: Quantitative sandwich ELISA for measuring Human Syndecan-2 (SDC2) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Syndecan-2 (SDC2) Kit |
KTE60728-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
Description: Quantitative sandwich ELISA for measuring Human Syndecan-2 (SDC2) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Syndecan-2 (SDC2) Kit |
KTE60728-96T |
Abbkine |
96T |
EUR 572 |
Description: Quantitative sandwich ELISA for measuring Human Syndecan-2 (SDC2) Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
SDC3 ORF Vector (Human) (pORF) |
ORF009277 |
ABM |
1.0 ug DNA |
EUR 95 |
Cow Syndecan-1 (SDC1) ELISA Kit |
abx518963-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Cow Syndecan-2 (SDC2) ELISA Kit |
abx519962-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Syndecan-2 (SDC2) ELISA Kit |
abx519965-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Monkey Syndecan 4 (SDC4) ELISA Kit |
abx359705-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Syndecan 4 (SDC4) ELISA Kit |
abx361493-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Syndecan 4 (SDC4) ELISA Kit |
abx362262-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Syndecan 4 (SDC4) ELISA Kit |
abx364294-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Pig Syndecan 1 (SDC1) ELISA Kit |
20-abx585009 |
Abbexa |
-
EUR 7504.00
-
EUR 3996.00
-
EUR 926.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Syndecan-1 (SDC1) ELISA Kit |
abx573871-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Syndecan-1 (SDC1) ELISA Kit |
abx574347-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Guinea pig Syndecan 4 ELISA kit |
E05S0064-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Syndecan 4 ELISA kit |
E05S0064-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Syndecan 4 ELISA kit |
E05S0064-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Syndecan 1/CD138 ELISA kit |
E03S0301-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Syndecan 1/CD138 ELISA kit |
E03S0301-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Syndecan 1/CD138 ELISA kit |
E03S0301-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Syndecan 1/CD138 ELISA kit |
E02S0301-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Syndecan 1/CD138 ELISA kit |
E02S0301-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Syndecan 1/CD138 ELISA kit |
E02S0301-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human SDC3(Syndecan 3) ELISA Kit