Human SDC3(Syndecan 3) ELISA Kit

Human SDC3(Syndecan 3) ELISA Kit

Human Syndecan 3 (SDC3) ELISA Kit

RD-SDC3-Hu-96Tests 96 Tests
EUR 723

Human Syndecan 3 (SDC3) ELISA Kit

RDR-SDC3-Hu-48Tests 48 Tests
EUR 544

Human Syndecan 3 (SDC3) ELISA Kit

RDR-SDC3-Hu-96Tests 96 Tests
EUR 756

Human Syndecan 3(SDC3) ELISA kit

E01S0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syndecan 3(SDC3) ELISA kit

E01S0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syndecan 3(SDC3) ELISA kit

E01S0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SDC3(Syndecan 3) ELISA Kit

EH3753 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: O75056
  • Alias: SDC3/N-Syndecan/KIAA0468/N-syndecan/SDCN/SYND3syndecan proteoglycan 3/syndecan 3/syndecan 3(N-syndecan)/syndecan neural type/syndecan-3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Syndecan- 3, SDC3 ELISA KIT

ELI-42371h 96 Tests
EUR 824

Human Syndecan 3 (SDC3) ELISA Kit

20-abx153206
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Syndecan 3 (SDC3) ELISA Kit

abx253142-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Syndecan-3(SDC3)ELISA Kit

CSB-E14984h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-3 (SDC3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Syndecan-3(SDC3)ELISA Kit

1-CSB-E14984h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-3(SDC3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Syndecan 3(SDC3)ELISA Kit

QY-E03730 96T
EUR 400

Human Syndecan 3 (SDC3) ELISA Kit

SED172Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 3 (SDC3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 3 (SDC3) in Tissue homogenates and other biological fluids.

Human Syndecan 3 (SDC3) ELISA Kit

SED172Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 3 (SDC3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 3 (SDC3) in Tissue homogenates and other biological fluids.

Human Syndecan 3 (SDC3) ELISA Kit

SED172Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 3 (SDC3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 3 (SDC3) in Tissue homogenates and other biological fluids.

Human Syndecan 3 (SDC3) ELISA Kit

SED172Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 3 (SDC3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 3 (SDC3) in Tissue homogenates and other biological fluids.

Human Syndecan 3 (SDC3) ELISA Kit

4-SED172Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Syndecan 3 elisa. Alternative names of the recognized antigen: SDCN
  • SYND3
  • N-Syndecan
  • Syndecan Proteoglycan 3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syndecan 3 (SDC3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Pig Syndecan 3 (SDC3) ELISA Kit

abx361300-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Syndecan 3 (SDC3) ELISA Kit

abx363411-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Syndecan 3(SDC3) ELISA kit

E03S0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syndecan 3(SDC3) ELISA kit

E03S0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syndecan 3(SDC3) ELISA kit

E03S0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syndecan 3(SDC3) ELISA kit

E02S0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syndecan 3(SDC3) ELISA kit

E02S0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syndecan 3(SDC3) ELISA kit

E02S0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Syndecan 3(SDC3) ELISA kit

E04S0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Syndecan 3(SDC3) ELISA kit

E04S0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Syndecan 3(SDC3) ELISA kit

E04S0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Syndecan 3(SDC3) ELISA kit

E06S0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Syndecan 3(SDC3) ELISA kit

E06S0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Syndecan 3(SDC3) ELISA kit

E06S0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Syndecan 3(SDC3) ELISA kit

E08S0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Syndecan 3(SDC3) ELISA kit

E08S0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Syndecan 3(SDC3) ELISA kit

E08S0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Syndecan 3(SDC3) ELISA kit

E07S0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Syndecan 3(SDC3) ELISA kit

E07S0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Syndecan 3(SDC3) ELISA kit

E07S0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Syndecan 3(SDC3) ELISA kit

E09S0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Syndecan 3(SDC3) ELISA kit

E09S0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Syndecan 3(SDC3) ELISA kit

E09S0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chicken Syndecan- 3, SDC3 ELISA KIT

ELI-19878c 96 Tests
EUR 928

Mouse Syndecan- 3, Sdc3 ELISA KIT

ELI-30487m 96 Tests
EUR 865

Chicken Syndecan 3 (SDC3) ELISA Kit

abx356132-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Syndecan 3 (SDC3) ELISA Kit

abx359497-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Syndecan-3(SDC3) ELISA kit

CSB-EL020890MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Syndecan-3 (SDC3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Syndecan-3(SDC3) ELISA kit

1-CSB-EL020890MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Syndecan-3(SDC3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Syndecan-3/SDC3 PicoKine ELISA Kit

EK1555 96 wells
EUR 425
Description: For quantitative detection of human Syndecan-3 in cell culture supernates , cell lysates, serum and plasma(heparin, EDTA).

ELISA kit for Human Syndecan-3/SDC3

EK5737 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Syndecan-3/SDC3 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human SDC3 (Syndecan 3)

ELK3691 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syndecan 3 (SDC3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syndecan 3 (SDC3
  • Show more
Description: A sandwich ELISA kit for detection of Syndecan 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human SDC3 (Syndecan 3)

E-EL-H1261 1 plate of 96 wells
EUR 534
  • Gentaur's SDC3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SDC3. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SDC3 (Syndecan 3) in samples from Serum, Plasma, Cell supernatant

Syndecan 3 (SDC3) Antibody

20-abx115958
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Syndecan 3 (SDC3) Antibody

20-abx174697
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Syndecan 3 (SDC3) Antibody

20-abx214134
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Syndecan-3 (SDC3) Antibody

abx238435-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Syndecan 3 (SDC3) Antibody

20-abx241466
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Syndecan 3 (SDC3) Antibody

20-abx178523
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Syndecan 3 (SDC3) CLIA Kit

abx196253-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Syndecan 3 (SDC3) CLIA Kit

20-abx494120
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Syndecan 3 (SDC3) Protein

20-abx655180
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Guinea pig Syndecan 3(SDC3) ELISA kit

E05S0351-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Syndecan 3(SDC3) ELISA kit

E05S0351-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Syndecan 3(SDC3) ELISA kit

E05S0351-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 3(SDC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syndecan-3/SDC3 PicoKine ELISA Kit

EK1556 96 wells
EUR 425
Description: For quantitative detection of mouse Syndecan-3 in cell culture supernates , cell lysates, serum and plasma(heparin, EDTA).

ELISA kit for Mouse Syndecan-3/SDC3

EK5738 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Syndecan-3/SDC3 in samples from serum, plasma, tissue homogenates and other biological fluids.

CLIA kit for Human SDC3 (Syndecan 3)

E-CL-H0818 1 plate of 96 wells
EUR 584
  • Gentaur's SDC3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human SDC3 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human SDC3 (Syndecan 3) in samples from Serum, Plasma, Cell supernatant

Anti-Syndecan 3/SDC3 Antibody

PA2133 100ug/vial
EUR 334

ELISA kit for Human Syndecan-1 (SDC3)

KTE60727-48T 48T
EUR 354
  • By screening a human fetal brain cDNA library with a fragment of the ectodomain of human SDC3, followed by ligation of overlapping clones, Berndt et al. (2001) obtained a full-length SDC3 cDNA. The deduced 443-amino acid protein contains a large extr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Syndecan-1 (SDC3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syndecan-1 (SDC3)

KTE60727-5platesof96wells 5 plates of 96 wells
EUR 2252
  • By screening a human fetal brain cDNA library with a fragment of the ectodomain of human SDC3, followed by ligation of overlapping clones, Berndt et al. (2001) obtained a full-length SDC3 cDNA. The deduced 443-amino acid protein contains a large extr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Syndecan-1 (SDC3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syndecan-1 (SDC3)

KTE60727-96T 96T
EUR 572
  • By screening a human fetal brain cDNA library with a fragment of the ectodomain of human SDC3, followed by ligation of overlapping clones, Berndt et al. (2001) obtained a full-length SDC3 cDNA. The deduced 443-amino acid protein contains a large extr
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Syndecan-1 (SDC3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sdc3/ Rat Sdc3 ELISA Kit

ELI-13422r 96 Tests
EUR 886

SDC3 ELISA KIT|Human

EF007158 96 Tests
EUR 689

SDC3 ELISA Kit (Human) (OKCD01742)

OKCD01742 96 Wells
EUR 831
Description: Description of target: Cell surface proteoglycan that may bear heparan sulfate. May have a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.226 ng/mL

SDC3 ELISA Kit (Human) (OKBB01081)

OKBB01081 96 Wells
EUR 505
Description: Description of target: Syndecan-3 is a protein that in humans is encoded by the SDC3 gene. The protein encoded by this gene belongs to the syndecan proteoglycan family, which was assigned to human chromosome 1p35.2, and it showed that in the mouse the Synd3 gene maps to chromosome 4 near the Lmyc gene. The transfection of SDC3 resulted in the formation of long filopodia-like structures, microspikes, and varicosities in several cell lines. Besides, the gene plays a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism. Allelic variants of this gene have been associated with obesity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

SDC3 ELISA Kit (Human) (OKCA02150)

OKCA02150 96 Wells
EUR 917
Description: Description of target: Cell surface proteoglycan that may bear heparan sulfate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.72 pg/mL

Sdc3 ELISA Kit (Mouse) (OKBB01082)

OKBB01082 96 Wells
EUR 505
Description: Description of target: Syndecan-3 is a protein that in humans is encoded by the SDC3 gene. The protein encoded by this gene belongs to the syndecan proteoglycan family, which was assigned to human chromosome 1p35.2, and it showed that in the mouse the Synd3 gene maps to chromosome 4 near the Lmyc gene. The transfection of SDC3 resulted in the formation of long filopodia-like structures, microspikes, and varicosities in several cell lines. Besides, the gene plays a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism. Allelic variants of this gene have been associated with obesity.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

SDC3 ELISA Kit (Mouse) (OKCA00929)

OKCA00929 96 Wells
EUR 833
Description: Description of target: Cell surface proteoglycan that may bear heparan sulfate. May have a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Human Syndecan 4 ELISA kit

E01S0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syndecan 4 ELISA kit

E01S0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syndecan 4 ELISA kit

E01S0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

SDC3 siRNA

20-abx904823
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Sdc3 antibody

70R-8670 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Sdc3 antibody

SDC3 Antibody

40231-100ul 100ul
EUR 252

SDC3 antibody

70R-20126 50 ul
EUR 435
Description: Rabbit polyclonal SDC3 antibody

SDC3 siRNA

20-abx932694
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDC3 siRNA

20-abx932695
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDC3 Antibody

1-CSB-PA925237
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SDC3. Recognizes SDC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

SDC3 Antibody

1-CSB-PA296842
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SDC3. Recognizes SDC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:40-1:150

SDC3 Antibody

1-CSB-PA020890GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SDC3. Recognizes SDC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF

Syndecan-3 Antibody

3824-100
EUR 354

Syndecan-3 Antibody

3824-30T
EUR 146

Syndecan 3 antibody

20R-1738 100 ug
EUR 673
Description: Rabbit polyclonal Syndecan 3 antibody

Syndecan 3 antibody

70R-12120 100 ug
EUR 460
Description: Rabbit polyclonal Syndecan 3 antibody

Syndecan-3 Antibody

DF12329 200ul
EUR 304
Description: Syndecan-3 antibody detects endogenous levels of Syndecan-3.

Human Syndecan-1 (SDC1) ELISA Kit

abx570426-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Syndecan 1 (SDC1) ELISA Kit

20-abx585066
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Syndecan 1/CD138 ELISA kit

E01S0301-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syndecan 1/CD138 ELISA kit

E01S0301-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Syndecan 1/CD138 ELISA kit

E01S0301-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Syndecan-1

EK4130 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Syndecan-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Syndecan-2

EK4472 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Syndecan-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human SDC1/ Syndecan-1 ELISA Kit

E2224Hu 1 Kit
EUR 571

Human SDC2/ Syndecan-2 ELISA Kit

E2225Hu 1 Kit
EUR 571

Syndecan-1 (SDC1) (Human) ELISA Kit

E4354-100
EUR 805

Human SDC1(Syndecan-1) ELISA Kit

EH0278 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P18827
  • Alias: Syndecan‑1/SDC1/CD138/SDC/syndecan/syndecan 1/syndecan proteoglycan 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human SDC4(Syndecan 4) ELISA Kit

EH3754 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: P31431
  • Alias: SDC4/Amphiglycan/Ryudocan/amphiglycan/Amphiglycan/MGC22217/ryudocan/Ryudocan core protein/SYND4ryudocan amphiglycan/syndecan 4/syndecan 4(amphiglycan, ryudocan)/syndecan proteoglycan 4/syndec
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Human Syndecan- 4, SDC4 ELISA KIT

ELI-13423h 96 Tests
EUR 824

Human Syndecan- 1, SDC1 ELISA KIT

ELI-06305h 96 Tests
EUR 824

Human Syndecan- 2, SDC2 ELISA KIT

ELI-07301h 96 Tests
EUR 824

Human Syndecan 1 (SDC1) ELISA Kit

20-abx153205
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Syndecan 4 (SDC4) ELISA Kit

20-abx153207
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Syndecan-2 (SDC2) ELISA Kit

abx251539-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Syndecan 1 (SDC1) ELISA Kit

abx252159-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Syndecan 4 (SDC4) ELISA Kit

abx253143-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Syndecan 1 (SDC1) ELISA Kit

DLR-SDC1-Hu-48T 48T
EUR 498
  • Should the Human Syndecan 1 (SDC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Syndecan 1 (SDC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Syndecan 1 (SDC1) ELISA Kit

DLR-SDC1-Hu-96T 96T
EUR 647
  • Should the Human Syndecan 1 (SDC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Syndecan 1 (SDC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Syndecan 4 (SDC4) ELISA Kit

DLR-SDC4-Hu-48T 48T
EUR 498
  • Should the Human Syndecan 4 (SDC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Syndecan 4 (SDC4) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Syndecan 4 (SDC4) ELISA Kit

DLR-SDC4-Hu-96T 96T
EUR 647
  • Should the Human Syndecan 4 (SDC4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Syndecan 4 (SDC4) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Syndecan-2(SDC2) ELISA kit

CSB-EL020889HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-2 (SDC2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Syndecan-2(SDC2) ELISA kit

1-CSB-EL020889HU
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-2(SDC2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human syndecan 4 (SDC4) ELISA kit

CSB-EL020891HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human syndecan 4 (SDC4) in samples from serum, plasma, cell lysates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human syndecan 4 (SDC4) ELISA kit

1-CSB-EL020891HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human syndecan 4 (SDC4) in samples from serum, plasma, cell lysates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Syndecan 4 (SDC4) ELISA Kit

SEB939Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 4 (SDC4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 4 (SDC4) in serum, plasma, tissue homogenates and other biological fluids.

Human Syndecan 4 (SDC4) ELISA Kit

SEB939Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 4 (SDC4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 4 (SDC4) in serum, plasma, tissue homogenates and other biological fluids.

Human Syndecan 4 (SDC4) ELISA Kit

SEB939Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 4 (SDC4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 4 (SDC4) in serum, plasma, tissue homogenates and other biological fluids.

Human Syndecan 4 (SDC4) ELISA Kit

SEB939Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 4 (SDC4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 4 (SDC4) in serum, plasma, tissue homogenates and other biological fluids.

Human Syndecan 4 (SDC4) ELISA Kit

4-SEB939Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Syndecan 4 elisa. Alternative names of the recognized antigen: SYND4
  • Amphiglycan
  • Ryudocan
  • Ryudocan core protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syndecan 4 (SDC4) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Syndecan 1 (SDC1) ELISA Kit

SEB966Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 1 (SDC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 1 (SDC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Syndecan 1 (SDC1) ELISA Kit

SEB966Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 1 (SDC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 1 (SDC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Syndecan 1 (SDC1) ELISA Kit

SEB966Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 1 (SDC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 1 (SDC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Syndecan 1 (SDC1) ELISA Kit

SEB966Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syndecan 1 (SDC1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syndecan 1 (SDC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Syndecan 1 (SDC1) ELISA Kit

4-SEB966Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Syndecan 1 elisa. Alternative names of the recognized antigen: CD138
  • SDC
  • SYND1
  • Syndecan Proteoglycan 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syndecan 1 (SDC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Syndecan 1 ELISA Kit (SDC1)

RK02253 96 Tests
EUR 521

Human Syndecan 4 ELISA Kit (SDC4)

RK02254 96 Tests
EUR 521

Human Syndecan 1 (SDC1) ELISA Kit

RD-SDC1-Hu-48Tests 48 Tests
EUR 500

Human Syndecan 1 (SDC1) ELISA Kit

RD-SDC1-Hu-96Tests 96 Tests
EUR 692

Human Syndecan 4 (SDC4) ELISA Kit

RD-SDC4-Hu-48Tests 48 Tests
EUR 500

Human Syndecan 4 (SDC4) ELISA Kit

RD-SDC4-Hu-96Tests 96 Tests
EUR 692

Human Syndecan 1 (SDC1) ELISA Kit

RDR-SDC1-Hu-48Tests 48 Tests
EUR 522

Human Syndecan 1 (SDC1) ELISA Kit

RDR-SDC1-Hu-96Tests 96 Tests
EUR 724

Human Syndecan 4 (SDC4) ELISA Kit

RDR-SDC4-Hu-48Tests 48 Tests
EUR 522

Human Syndecan 4 (SDC4) ELISA Kit

RDR-SDC4-Hu-96Tests 96 Tests
EUR 724

Human Syndecan 4(SDC4)ELISA Kit

QY-E03729 96T
EUR 400

Human Syndecan 1(SDC1)ELISA Kit

QY-E03731 96T
EUR 400

Human SDC3 shRNA Plasmid

20-abx956446
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SDC3 Recombinant Protein (Human)

RP027829 100 ug Ask for price

SDC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2107604 1.0 ug DNA
EUR 154

Rat Syndecan 4 ELISA kit

E02S0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syndecan 4 ELISA kit

E02S0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syndecan 4 ELISA kit

E02S0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syndecan 4 ELISA kit

E03S0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syndecan 4 ELISA kit

E03S0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syndecan 4 ELISA kit

E03S0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Syndecan 4 ELISA kit

E04S0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Syndecan 4 ELISA kit

E04S0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Syndecan 4 ELISA kit

E04S0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Syndecan 4 ELISA kit

E06S0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Syndecan 4 ELISA kit

E06S0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Syndecan 4 ELISA kit

E06S0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Syndecan 4 ELISA kit

E07S0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Syndecan 4 ELISA kit

E07S0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Syndecan 4 ELISA kit

E07S0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Syndecan 4 ELISA kit

E08S0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Syndecan 4 ELISA kit

E08S0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Syndecan 4 ELISA kit

E08S0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Syndecan 4 ELISA kit

E09S0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Syndecan 4 ELISA kit

E09S0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Syndecan 4 ELISA kit

E09S0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FSH (Human Follicle-stimulating hormone) ELISA test

3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)

ELISA kit for Human Syndecan-4/SDC4

EK5623 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Syndecan-4/SDC4 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human SDC1/Syndecan-1 PicoKine ELISA Kit

EK1339 96 wells
EUR 425
Description: For quantitative detection of human Syndecan-1 in cell culture supernates and serum.

Human Syndecan-4/SDC4 PicoKine ELISA Kit

EK1356 96 wells
EUR 425
Description: For quantitative detection of human Syndecan-4 in cell culture supernates, serum and plasma(heparin, EDTA).

ELISA kit for Human SDC4 (Syndecan 4)

ELK2690 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syndecan 4 (SDC4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syndecan 4 (SDC4
  • Show more
Description: A sandwich ELISA kit for detection of Syndecan 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human SDC1 (Syndecan 1)

ELK2716 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syndecan 1 (SDC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syndecan 1 (SDC1
  • Show more
Description: A sandwich ELISA kit for detection of Syndecan 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Syndecan-1/CD138(SDC1) ELISA Kit

CSB-E14983h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-1/CD138 (SDC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Syndecan-1/CD138(SDC1) ELISA Kit

1-CSB-E14983h
  • EUR 574.00
  • EUR 4013.00
  • EUR 2138.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Syndecan-1/CD138(SDC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human SDC1 (Syndecan 1)

E-EL-H1298 1 plate of 96 wells
EUR 534
  • Gentaur's SDC1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SDC1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SDC1 (Syndecan 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human SDC4 (Syndecan 4)

E-EL-H1682 1 plate of 96 wells
EUR 534
  • Gentaur's SDC4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SDC4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SDC4 (Syndecan 4) in samples from Serum, Plasma, Cell supernatant

Syndecan-4/SDC4 ELISA Kit (Human) (OKBB00392)

OKBB00392 96 Wells
EUR 505
Description: Description of target: Syndecan-4 (SDC4) is a protein that in humans is encoded by the SDC4 gene. The protein is found as a homodimer and is a member of the syndecan proteoglycan family. It is mapped to 20q13.12. Syndecan-4 is one of the four vertebrate syndecans and has a molecular weight of ~20 kDa. It is a transmembrane (type I) heparan sulfate proteoglycan that functions as a receptor in intracellular signaling. Syndecan-4 also regulates the actin cytoskeleton, cell adhesion, and cell migration. In addition, Syndecan-4 can activate protein kinase C (PKC). The variable domain of syndecan-4 could be a site of self-association. What’s more, Syndecan-4 also binds to phosphatidylinositol (4,5)-bisphosphate (PIP2) through the variable domain and increases PKC activity ten-fold.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

SDC1/Syndecan-1 ELISA Kit (Human) (OKBB00608)

OKBB00608 96 Wells
EUR 505
Description: Description of target: Syndecan 1, also known as SYND1 or CD138, is a protein which in humans is encoded by the SDC1 gene. The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. This gene is mapped to 2p24.1. The syndecans mediate cell binding, cell signaling, cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan 1 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. What’s more, Syndecan-1 is also a sponge for growth factors, with binding largely via heparan sulfate chains.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Polyclonal Syndecan-3 Antibody

AMM08059G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Syndecan-3 . This antibody is tested and proven to work in the following applications:

anti- Syndecan-3 antibody

FNab08435 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: syndecan 3
  • Uniprot ID: O75056
  • Gene ID: 9672
  • Research Area: Cardiovascular
Description: Antibody raised against Syndecan-3

Syndecan 3 Blocking Peptide

33R-10555 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Syndecan 3 antibody, catalog no. 20R-1738

Syndecan 3 Blocking Peptide

33R-10937 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Syndecan 3 antibody, catalog no. 70R-12120

Syndecan-3 Blocking Peptide

3824BP-50
EUR 153

Syndecan-3 Blocking Peptide

DF12329-BP 1mg
EUR 195

Anti-Syndecan-3 antibody

PAab08435 100 ug
EUR 386

SDC3 Conjugated Antibody

C40231 100ul
EUR 397

SDC3 cloning plasmid

CSB-CL020890HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1113
  • Sequence: atggccattgcttacctgggatcctcatgcccctcacaaccacccagctccctagctctctccctctcccccaccccctcagacttcgagcaggagtcgggcattgagacagccatgcgcttcagcccagatgtagccctggcggtgtccaccacaccatttgaagagctcccct
  • Show more
Description: A cloning plasmid for the SDC3 gene.

SDC3 Rabbit pAb

A18312-100ul 100 ul
EUR 308

SDC3 Rabbit pAb

A18312-200ul 200 ul
EUR 459

SDC3 Rabbit pAb

A18312-20ul 20 ul
EUR 183

SDC3 Rabbit pAb

A18312-50ul 50 ul
EUR 223

Sdc3 Blocking Peptide

33R-3406 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Sdc3 antibody, catalog no. 70R-8670

Anti-SDC3 antibody

STJ11100268 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the syndecan proteoglycan family. It may play a role in the organization of cell shape by affecting the actin cytoskeleton, possibly by transferring signals from the cell surface in a sugar-dependent mechanism. Allelic variants of this gene have been associated with obesity.

ELISA kit for Human Syndecan-2 (SDC2)  Kit

KTE60728-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Syndecan-2 (SDC2)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syndecan-2 (SDC2)  Kit

KTE60728-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Syndecan-2 (SDC2)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syndecan-2 (SDC2)  Kit

KTE60728-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Syndecan-2 (SDC2)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SDC3 ORF Vector (Human) (pORF)

ORF009277 1.0 ug DNA
EUR 95

Cow Syndecan-1 (SDC1) ELISA Kit

abx518963-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Cow Syndecan-2 (SDC2) ELISA Kit

abx519962-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Syndecan-2 (SDC2) ELISA Kit

abx519965-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Monkey Syndecan 4 (SDC4) ELISA Kit

abx359705-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Syndecan 4 (SDC4) ELISA Kit

abx361493-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Syndecan 4 (SDC4) ELISA Kit

abx362262-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Syndecan 4 (SDC4) ELISA Kit

abx364294-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Pig Syndecan 1 (SDC1) ELISA Kit

20-abx585009
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Syndecan-1 (SDC1) ELISA Kit

abx573871-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Syndecan-1 (SDC1) ELISA Kit

abx574347-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Guinea pig Syndecan 4 ELISA kit

E05S0064-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Syndecan 4 ELISA kit

E05S0064-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Syndecan 4 ELISA kit

E05S0064-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Syndecan 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syndecan 1/CD138 ELISA kit

E03S0301-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syndecan 1/CD138 ELISA kit

E03S0301-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Syndecan 1/CD138 ELISA kit

E03S0301-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syndecan 1/CD138 ELISA kit

E02S0301-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syndecan 1/CD138 ELISA kit

E02S0301-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Syndecan 1/CD138 ELISA kit

E02S0301-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Syndecan 1/CD138 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SDC3(Syndecan 3) ELISA Kit