Hudsen

Human brain gene expression atlas project

Human SMTN(Smoothelin) ELISA Kit

Human SMTN(Smoothelin) ELISA Kit

Human Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Hu-48Tests 48 Tests
EUR 544

Human Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Hu-96Tests 96 Tests
EUR 756

Rat Smoothelin (SMTN) ELISA Kit

DLR-SMTN-Ra-48T 48T
EUR 549
  • Should the Rat Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

DLR-SMTN-Ra-96T 96T
EUR 718
  • Should the Rat Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

RD-SMTN-Ra-48Tests 48 Tests
EUR 557

Rat Smoothelin (SMTN) ELISA Kit

RD-SMTN-Ra-96Tests 96 Tests
EUR 775

Rat Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Ra-48Tests 48 Tests
EUR 583

Rat Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Ra-96Tests 96 Tests
EUR 811

Human Smoothelin (SMTN) ELISA Kit

20-abx153124
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Smoothelin, SMTN ELISA KIT

ELI-52975h 96 Tests
EUR 824

Human Smoothelin(SMTN)ELISA Kit

QY-E04585 96T
EUR 361

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

4-SEC856Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Smoothelin (SMTN) ELISA Kit

20-abx156101
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Smoothelin, Smtn ELISA KIT

ELI-19062m 96 Tests
EUR 865

Mouse Smoothelin (SMTN) ELISA Kit

abx390587-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

4-SEC856Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Smoothelin (SMTN) Antibody

20-abx006625
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Smoothelin (SMTN) Antibody

20-abx128197
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Smoothelin (SMTN) Antibody

20-abx130055
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Smoothelin (SMTN) Antibody

20-abx174576
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Smoothelin (SMTN) Antibody

20-abx174577
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Smoothelin (SMTN)

4-RPC856Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P53814
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Smoothelin expressed in: E.coli

Recombinant Smoothelin (SMTN)

4-RPC856Ra01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4ABA5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Smoothelin expressed in: E.coli

ELISA kit for Human SMTN (Smoothelin)

ELK4065 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN
  • Show more
Description: A sandwich ELISA kit for detection of Smoothelin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Smoothelin (SMTN) CLIA Kit

20-abx493940
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Smoothelin (SMTN) Protein

20-abx166596
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Rat SMTN (Smoothelin)

ELK6982 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN
  • Show more
Description: A sandwich ELISA kit for detection of Smoothelin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Smoothelin (SMTN) CLIA Kit

20-abx493941
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Smtn ELISA Kit| Mouse Smoothelin ELISA Kit

EF016229 96 Tests
EUR 689

Anti-Smoothelin/SMTN Antibody

A04895 100ug/vial
EUR 294

Rat Smoothelin (SMTN) Protein

20-abx167608
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Smoothelin (SMTN) Polyclonal Antibody (Human)

4-PAC856Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN)

Smoothelin (SMTN) Polyclonal Antibody (Rat)

4-PAC856Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN)

Smoothelin (SMTN) Polyclonal Antibody (Human), APC

4-PAC856Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC.

Smoothelin (SMTN) Polyclonal Antibody (Human), Biotinylated

4-PAC856Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Biotin.

Smoothelin (SMTN) Polyclonal Antibody (Human), Cy3

4-PAC856Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Cy3.

Smoothelin (SMTN) Polyclonal Antibody (Human), FITC

4-PAC856Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with FITC.

Smoothelin (SMTN) Polyclonal Antibody (Human), HRP

4-PAC856Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with HRP.

Smoothelin (SMTN) Polyclonal Antibody (Human), PE

4-PAC856Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with PE.

Smoothelin (SMTN) Polyclonal Antibody (Human), APC-Cy7

4-PAC856Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC-Cy7.

Smoothelin (SMTN) Polyclonal Antibody (Rat), APC

4-PAC856Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC.

Smoothelin (SMTN) Polyclonal Antibody (Rat), Biotinylated

4-PAC856Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Biotin.

Smoothelin (SMTN) Polyclonal Antibody (Rat), Cy3

4-PAC856Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Cy3.

Smoothelin (SMTN) Polyclonal Antibody (Rat), FITC

4-PAC856Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with FITC.

Smoothelin (SMTN) Polyclonal Antibody (Rat), HRP

4-PAC856Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with HRP.

Smoothelin (SMTN) Polyclonal Antibody (Rat), PE

4-PAC856Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with PE.

Smoothelin (SMTN) Polyclonal Antibody (Rat), APC-Cy7

4-PAC856Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC-Cy7.

SMTN ELISA KIT|Human

EF005579 96 Tests
EUR 689

SMTN ELISA Kit (Human) (OKCD00885)

OKCD00885 96 Wells
EUR 831
Description: Description of target: Structural protein of the cytoskeleton. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

SMTN ELISA Kit (Rat) (OKCD01249)

OKCD01249 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.25 ng/mL

Smoothelin antibody

10R-8118 100 ug
EUR 467
Description: Mouse monoclonal Smoothelin antibody

Smoothelin Antibody

20-abx141519
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-Human Smoothelin antibody

STJ16100450 1 mL
EUR 1396

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

SMTN siRNA

20-abx934461
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SMTN siRNA

20-abx934462
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Smoothelin- like protein 2, SMTNL2 ELISA KIT

ELI-30344h 96 Tests
EUR 824

Human Smoothelin- like protein 1, SMTNL1 ELISA KIT

ELI-07294h 96 Tests
EUR 824

Human Smoothelin-like protein 2 (SMTNL2) ELISA Kit

abx383323-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Smoothelin-like protein 1 (SMTNL1) ELISA Kit

abx519955-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human SMTN shRNA Plasmid

20-abx954419
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-Smoothelin antibody

STJ16100219 100 µg
EUR 446

Anti-Smoothelin antibody

STJ180240 0.1 ml
EUR 237

SMTN Polyclonal Antibody

30729-100ul 100ul
EUR 252

SMTN Polyclonal Antibody

30729-50ul 50ul
EUR 187

SMTN cloning plasmid

CSB-CL021855HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2748
  • Sequence: atggcggacgaggccttagctgggctggatgagggagcccttcggaagctgctggaggtcacagcagatctggcagagcggcggcgcatccgctcagccatccgggaactgcagcggcaggagctggagcgcgaggaggaggccctggcatccaagcgtttccgtgccgagcggc
  • Show more
Description: A cloning plasmid for the SMTN gene.

SMTN Rabbit pAb

A6745-100ul 100 ul
EUR 308

SMTN Rabbit pAb

A6745-200ul 200 ul
EUR 459

SMTN Rabbit pAb

A6745-20ul 20 ul
EUR 183

SMTN Rabbit pAb

A6745-50ul 50 ul
EUR 223

Anti-SMTN antibody

STJ28828 100 µl
EUR 277
Description: This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms.

Mouse Smoothelin- like protein 2, Smtnl2 ELISA KIT

ELI-19984m 96 Tests
EUR 865

Mouse Smoothelin- like protein 1, Smtnl1 ELISA KIT

ELI-07295m 96 Tests
EUR 865

Mouse Smoothelin-like protein 1 (SMTNL1) ELISA Kit

abx519956-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Smoothelin-like protein 2 (SMTNL2) ELISA Kit

abx390588-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine Smoothelin- like protein 2, SMTNL2 ELISA KIT

ELI-39438b 96 Tests
EUR 928

Smtnl2 ELISA Kit| Mouse Smoothelin-like protein 2 ELISA Kit

EF016230 96 Tests
EUR 689

SMTNL2 ELISA Kit| Bovine Smoothelin-like protein 2 ELISA Kit

EF011910 96 Tests
EUR 689

SMTN ORF Vector (Human) (pORF)

ORF009816 1.0 ug DNA
EUR 95

Human Smoothelin-Like 1 Phospho-Ser301 (SMTNL1 pS301) ELISA Kit

abx259851-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse SMTN shRNA Plasmid

20-abx973993
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SMTN Polyclonal Conjugated Antibody

C30729 100ul
EUR 397

pENTR223-SMTN-G1939C vector

PVT11820 2 ug
EUR 304

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

SMTN sgRNA CRISPR Lentivector set (Human)

K2204001 3 x 1.0 ug
EUR 339

Smoothelin-Like 1 (SMTNL1) Antibody

20-abx115625
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Smoothelin-Like 2 (SMTNL2) Antibody

20-abx115626
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Smtn ORF Vector (Rat) (pORF)

ORF076722 1.0 ug DNA
EUR 506

Smtn ORF Vector (Mouse) (pORF)

ORF058025 1.0 ug DNA
EUR 506

Smtn ORF Vector (Mouse) (pORF)

ORF058026 1.0 ug DNA
EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

SMTN sgRNA CRISPR Lentivector (Human) (Target 1)

K2204002 1.0 ug DNA
EUR 154

SMTN sgRNA CRISPR Lentivector (Human) (Target 2)

K2204003 1.0 ug DNA
EUR 154

SMTN sgRNA CRISPR Lentivector (Human) (Target 3)

K2204004 1.0 ug DNA
EUR 154

SMTN Protein Vector (Human) (pPB-C-His)

PV039261 500 ng
EUR 329

SMTN Protein Vector (Human) (pPB-N-His)

PV039262 500 ng
EUR 329

SMTN Protein Vector (Human) (pPM-C-HA)

PV039263 500 ng
EUR 329

SMTN Protein Vector (Human) (pPM-C-His)

PV039264 500 ng
EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Smoothelin-Like Protein 2 (SMTNL2) Antibody

abx026407-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Smoothelin-Like Protein 2 (SMTNL2) Antibody

abx026407-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Smoothelin-Like Protein 2 (SMTNL2) Antibody

20-abx004012
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Smoothelin-Like Protein 2 (SMTNL2) Antibody

abx238044-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human SMTN(Smoothelin) ELISA Kit