Human STH(Saitohin) ELISA Kit

Human STH(Saitohin) ELISA Kit

Human Saitohin (STH) ELISA Kit

RDR-STH-Hu-48Tests 48 Tests
EUR 544

Human Saitohin (STH) ELISA Kit

RDR-STH-Hu-96Tests 96 Tests
EUR 756

Human Saitohin (STH)

1-CSB-EP022827HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 29.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Saitohin(STH) expressed in E.coli

Human Saitohin (STH) ELISA Kit

20-abx153012
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Saitohin (STH) ELISA Kit

abx253789-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human STH/ Saitohin ELISA Kit

E2415Hu 1 Kit
EUR 571

Human STH(Saitohin) ELISA Kit

EH0832 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8IWL8
  • Alias: STH/Saitohin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Saitohin (STH) ELISA Kit

abx572659-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Saitohin(STH)ELISA Kit

QY-E04614 96T
EUR 361

Human Saitohin (STH) ELISA Kit

SEE158Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.

Human Saitohin (STH) ELISA Kit

SEE158Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.

Human Saitohin (STH) ELISA Kit

SEE158Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.

Human Saitohin (STH) ELISA Kit

SEE158Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Saitohin (STH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Saitohin (STH) in Tissue homogenates and other biological fluids.

Human Saitohin (STH) ELISA Kit

4-SEE158Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Saitohin elisa. Alternative names of the recognized antigen: MAPTIT
  • Microtubule-Associated Protein Tau Intronic Transcript
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Saitohin (STH) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Saitohin (STH) Antibody

20-abx178306
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Saitohin (STH) Antibody

20-abx174455
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Saitohin (STH) Protein

20-abx654985
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Saitohin (STH) CLIA Kit

20-abx494522
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human STH (Saitohin)

ELK3836 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Saitohin (STH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Saitohin (STH). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Saitohin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Saitohin (STH)

KTE60386-48T 48T
EUR 332
  • During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Saitohin (STH)

KTE60386-5platesof96wells 5 plates of 96 wells
EUR 2115
  • During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Saitohin (STH)

KTE60386-96T 96T
EUR 539
  • During the examination of ESTs in the human tau locus, Conrad et al. (2002) identified a gene they designated saitohin, or STH, in honor of the late Dr. Tsuanao Saitoh and his laboratory. The STH gene encodes a predicted 128-amino acid protein.highes
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Saitohin (STH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human STH ELISA Kit

ELA-E0304h 96 Tests
EUR 824

STH ELISA KIT|Human

EF000551 96 Tests
EUR 689

STH ELISA Kit (Human) (OKCD08609)

OKCD08609 96 Wells
EUR 975
Description: Description of target: The function of this protein remains unknown.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.103ng/mL

STH ELISA Kit (Human) (OKEH04189)

OKEH04189 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.067 ng/mL

STH Antibody

1-CSB-PA022827LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

STH siRNA

20-abx935443
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human STH shRNA Plasmid

20-abx966624
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STH Recombinant Protein (Human)

RP043813 100 ug Ask for price

STH cloning plasmid

CSB-CL022827HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 387
  • Sequence: atgagtgagggtggaggccaagtctcatgcatttttgcagcccccacaagactgtgcaggtggccggccctcattgaatgcggggttaatttaactcagcctctgtgtgagtggatgattcaggttgccagagacagaaccctcagcttagcatgggaagtagcttccctgttgac
  • Show more
Description: A cloning plasmid for the STH gene.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

STH ORF Vector (Human) (pORF)

ORF014605 1.0 ug DNA
EUR 354

STH Antibody, HRP conjugated

1-CSB-PA022827LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STH Antibody, FITC conjugated

1-CSB-PA022827LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STH Antibody, Biotin conjugated

1-CSB-PA022827LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STH. Recognizes STH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

STH sgRNA CRISPR Lentivector set (Human)

K2302001 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

STH sgRNA CRISPR Lentivector (Human) (Target 1)

K2302002 1.0 ug DNA
EUR 154

STH sgRNA CRISPR Lentivector (Human) (Target 2)

K2302003 1.0 ug DNA
EUR 154

STH sgRNA CRISPR Lentivector (Human) (Target 3)

K2302004 1.0 ug DNA
EUR 154

STH Protein Vector (Human) (pPB-C-His)

PV058417 500 ng
EUR 481

STH Protein Vector (Human) (pPB-N-His)

PV058418 500 ng
EUR 481

STH Protein Vector (Human) (pPM-C-HA)

PV058419 500 ng
EUR 481

STH Protein Vector (Human) (pPM-C-His)

PV058420 500 ng
EUR 481

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Recombinant Human Saitohin Protein, His-SUMO, E.coli-100ug

QP6736-ec-100ug 100ug
EUR 408

Recombinant Human Saitohin Protein, His-SUMO, E.coli-10ug

QP6736-ec-10ug 10ug
EUR 200

Recombinant Human Saitohin Protein, His-SUMO, E.coli-1mg

QP6736-ec-1mg 1mg
EUR 1632

Recombinant Human Saitohin Protein, His-SUMO, E.coli-200ug

QP6736-ec-200ug 200ug
EUR 634

Recombinant Human Saitohin Protein, His-SUMO, E.coli-500ug

QP6736-ec-500ug 500ug
EUR 1060

Recombinant Human Saitohin Protein, His-SUMO, E.coli-50ug

QP6736-ec-50ug 50ug
EUR 263

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Human STH(Saitohin) ELISA Kit