Human SYNC(Syncoilin) ELISA Kit

Human SYNC(Syncoilin) ELISA Kit

Human Syncoilin (SYNC) ELISA Kit
RDR-SYNC-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Syncoilin, SYNC ELISA KIT
ELI-53119h	Lifescience Market	96 Tests	EUR 824

Human Syncoilin (SYNC) ELISA Kit
20-abx153203	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Syncoilin(SYNC)ELISA Kit
QY-E00204	Qayee Biotechnology	96T	EUR 361

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
SEF891Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Syncoilin (SYNC) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Syncoilin (SYNC) in Tissue homogenates and other biological fluids.

Human Syncoilin (SYNC) ELISA Kit
4-SEF891Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Syncoilin elisa. Alternative names of the recognized antigen: Syncoilin-1 Intermediate Filament Protein Syncoilin intermediate filament 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Syncoilin (SYNC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Syncoilin (SYNC) Antibody
20-abx128347	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Syncoilin (SYNC) Antibody
20-abx174693	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Syncoilin (SYNC) Antibody
20-abx310668	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody
abx238433-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Syncoilin (SYNC)
4-RPF891Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H7C4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 64.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Syncoilin expressed in: E.coli

Mouse Syncoilin, Sync ELISA KIT
ELI-41064m	Lifescience Market	96 Tests	EUR 865

Human Syncoilin (SYNC) Protein
20-abx166532	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Human SYNC (Syncoilin)
ELK3923	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Syncoilin (SYNC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Syncoilin (SYNC). Show more
Description: A sandwich ELISA kit for detection of Syncoilin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)
KTE60412-48T	Abbkine	48T	EUR 332
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)
KTE60412-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Syncoilin (SYNC)
KTE60412-96T	Abbkine	96T	EUR 539
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Human Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Syncoilin (SYNC) CLIA Kit
20-abx495048	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse Syncoilin (SYNC)
KTE70284-48T	Abbkine	48T	EUR 332
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Syncoilin (SYNC)
KTE70284-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Syncoilin (SYNC)
KTE70284-96T	Abbkine	96T	EUR 539
Syncollin is a 13 kDa protein that is highly expressed in the exocrine pancreas. Syncollin normally exists as a doughnut-shaped homo-oligomer (quite probably a hexamer) in close association with the luminal surface of the zymogen granule membrane. Fu Show more
Description: Quantitative sandwich ELISA for measuring Mouse Syncoilin (SYNC) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syncoilin (SYNC) Antibody (HRP)
20-abx310669	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody (FITC)
20-abx310670	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Antibody (Biotin)
20-abx310671	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine)
4-PAF891Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC)

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC
4-PAF891Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Biotinylated
4-PAF891Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Biotin.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), Cy3
4-PAF891Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with Cy3.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), FITC
4-PAF891Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with FITC.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), HRP
4-PAF891Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with HRP.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), PE
4-PAF891Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with PE.

Syncoilin (SYNC) Polyclonal Antibody (Human, Mouse, Rat, Pig, Bovine), APC-Cy7
4-PAF891Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SYNC (Ile169~Pro458) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig, Bovine Syncoilin (SYNC). This antibody is labeled with APC-Cy7.

SYNC ELISA KIT|Human
EF003394	Lifescience Market	96 Tests	EUR 689

SYNC ELISA Kit (Human) (OKCD00987)
OKCD00987	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Atypical type III intermediate filament (IF) protein that may play a supportive role in the efficient coupling of mechanical stress between the myofibril and fiber exterior. May facilitate lateral force transmission during skeletal muscle contraction. Does not form homofilaments nor heterofilaments with other IF proteins.By similarity <p>Manually curated information which has been propagated from a related experimentally characterized protein.</p> <p><a href="/manual/evidences#ECO:0000250">More…</a></p> Manual assertion inferred from sequence similarity toiUniProtKB:Q9EPM5 (SYNCI_MOUSE) ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

SYNC siRNA
20-abx935788	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYNC siRNA
20-abx935789	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SYNC Antibody
1-CSB-PA862034LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYNC. Recognizes SYNC from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human SYNC shRNA Plasmid
20-abx962976	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Sync Recombinant Protein (Human)
RP043876	ABM	100 ug	Ask for price

anti- SYNC antibody
FNab08433	FN Test	100µg	EUR 548.75
Immunogen: syncoilin, intermediate filament protein Uniprot ID: Q9H7C4 Research Area: Neuroscience
Description: Antibody raised against SYNC

SYNC Polyclonal Antibody
A67194	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SYNC cloning plasmid
CSB-CL862034HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 456 Sequence: ATGGCAGAGAGCCGCCAGGACCTGGAGGAGGAGTATGAGCCTCAGTTCCTGCGGCTCCTAGAGAGGAAAGAAGCTGGGACCAAAGCTCTGCAGAGAACCCAGGCTGAGATCCAGGAAATGAAGGAGGCTCTGAGACCCCTGCAAGCAGAGGCCCGGCAGCTCCGCCTGCAAAACAG Show more
Description: A cloning plasmid for the SYNC gene.

Anti-SYNC antibody
PAab08433	Lifescience Market	100 ug	EUR 386

Human SYNC(Syncoilin) ELISA Kit