Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit

Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

RDR-TGOLN2-Hu-48Tests 48 Tests
EUR 544

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

RDR-TGOLN2-Hu-96Tests 96 Tests
EUR 756

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

RD-TGOLN2-Hu-48Tests 48 Tests
EUR 521

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

RD-TGOLN2-Hu-96Tests 96 Tests
EUR 723

Trans Golgi Network Protein 2 (TGOLN2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Trans-Golgi Network Protein 2 (TGOLN2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Trans Golgi Network Protein 2 (TGOLN2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Trans Golgi Network Protein 2 (TGOLN2) Antibody

abx034174-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Trans Golgi Network Protein 2 (TGOLN2) Antibody

abx034174-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Trans Golgi Network Protein 2 (TGOLN2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Trans Golgi NeTwork Protein 2 (TGOLN2)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O43493
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Trans Golgi NeTwork Protein 2 expressed in: E.coli

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

abx257683-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Trans Golgi Network Protein 2(TGOLN2)ELISA Kit

QY-E03673 96T
EUR 400

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

SEH035Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

SEH035Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

SEH035Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

SEH035Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Trans Golgi Network Protein 2 (TGOLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in Tissue homogenates, cell lysates and other biological fluids.

Human Trans Golgi Network Protein 2 (TGOLN2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Trans Golgi Network Protein 2 elisa. Alternative names of the recognized antigen: TGN51
  • TGN46
  • TGN48
  • TGN38
  • TTGN2
  • Trans-Golgi Network Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Trans Golgi Network Protein 2 (TGOLN2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Trans Golgi Network Protein 2 (TGOLN2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Trans Golgi Network Protein 2 (TGOLN2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human TGOLN2 (Trans Golgi Network Protein 2)

ELK3891 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Trans Golgi Network Protein 2 (TGOLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specifi
  • Show more
Description: A sandwich ELISA kit for detection of Trans Golgi Network Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2)

Human TGOLN2 (Trans-Golgi network integral membrane protein 2) ELISA Kit

EH4979 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O43493
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Biotin.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with Cy3.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with FITC.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with HRP.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with PE.

Trans Golgi Network Protein 2 (TGOLN2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGOLN2 (Ala22~Glu323)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Trans Golgi Network Protein 2 (TGOLN2). This antibody is labeled with APC-Cy7.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody

abx411988-01ml 0.1 ml
EUR 704
  • Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody

abx412473-01ml 0.1 ml
EUR 704
  • Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody

abx412474-25ug 25 ug
EUR 1121
  • Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody

abx412475-10ug 10 ug
EUR 606
  • Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein 2 (TGN46) Antibody

abx238653-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody

abx411994-01ml 0.1 ml
EUR 704
  • Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody

abx412471-01ml 0.1 ml
EUR 801
  • Shipped within 1 week.

Trans-Golgi Network Integral Membrane Protein TGN38 (TTGN1) Antibody

abx412472-25ug 25 ug
EUR 801
  • Shipped within 1 week.


EF000179 96 Tests
EUR 689


ELI-29291h 96 Tests
EUR 824

TGOLN2 ELISA Kit (Human) (OKCD01017)

OKCD01017 96 Wells
EUR 831
Description: Description of target: May be involved in regulating membrane traffic to and from trans-Golgi network. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

Mouse Tgoln2 ELISA KIT

ELI-29292m 96 Tests
EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

TGOLN2 Recombinant Protein (Human)

RP031417 100 ug Ask for price

TGOLN2 Recombinant Protein (Human)

RP031420 100 ug Ask for price

Human Golgi Protein 73 ELISA kit

E01G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Golgi Protein 73 ELISA kit

E01G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Golgi Protein 73 ELISA kit

E01G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Golgi reassembly- stacking protein 2, GORASP2 ELISA KIT

ELI-39015h 96 Tests
EUR 824

Human Golgi Reassembly Stacking Protein 2 (GORASP2) ELISA Kit

abx387624-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TGOLN2 antibody

70R-21719 50 ul
EUR 435
Description: Rabbit polyclonal TGOLN2 antibody

TGOLN2 antibody

70R-7394 50 ug
EUR 467
Description: Rabbit polyclonal TGOLN2 antibody raised against the N terminal of TGOLN2

TGOLN2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TGOLN2. Recognizes TGOLN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Human ERGIC And Golgi 2 (ERGIC2) ELISA Kit

abx387183-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

TGOLN2 Recombinant Protein (Mouse)

RP178508 100 ug Ask for price

Human Golgi Protein 73 (GP73) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Golgi Protein 73 (GP73) ELISA Kit

abx052512-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Golgi Protein 73 (GP73) ELISA Kit

abx252562-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Golgi Protein 73 (GP73) ELISA Kit

DLR-GP73-Hu-48T 48T
EUR 498
  • Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit

DLR-GP73-Hu-96T 96T
EUR 647
  • Should the Human Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit

SEB668Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit

SEB668Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit

SEB668Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit

SEB668Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Human Golgi Protein 73 (GP73) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
  • GOLPH2
  • C9orf155
  • Golgi Membrane Protein 1
  • Golgi Phosphoprotein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Golgi Protein 73 ELISA Kit (GP73)

RK01490 96 Tests
EUR 521

Human Golgi Protein 73 (GP73) ELISA Kit

RD-GP73-Hu-48Tests 48 Tests
EUR 500

Human Golgi Protein 73 (GP73) ELISA Kit

RD-GP73-Hu-96Tests 96 Tests
EUR 692

Human Golgi Protein 73 (GP73) ELISA Kit

RDR-GP73-Hu-48Tests 48 Tests
EUR 522

Human Golgi Protein 73 (GP73) ELISA Kit

RDR-GP73-Hu-96Tests 96 Tests
EUR 724


GK7230-25G 25 g
EUR 54

TGOLN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2366803 1.0 ug DNA
EUR 154

Human TGOLN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Golgi reassembly- stacking protein 2, Gorasp2 ELISA KIT

ELI-27852m 96 Tests
EUR 865


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Goat Golgi Protein 73 ELISA kit

E06G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Golgi Protein 73 ELISA kit

E06G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Golgi Protein 73 ELISA kit

E06G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Golgi Protein 73 ELISA kit

E02G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Golgi Protein 73 ELISA kit

E02G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Golgi Protein 73 ELISA kit

E02G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Golgi Protein 73 ELISA kit

E03G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Golgi Protein 73 ELISA kit

E03G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Golgi Protein 73 ELISA kit

E03G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Golgi Protein 73 ELISA kit

E04G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Golgi Protein 73 ELISA kit

E04G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Golgi Protein 73 ELISA kit

E04G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Golgi Protein 73 ELISA kit

E08G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Golgi Protein 73 ELISA kit

E08G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Golgi Protein 73 ELISA kit

E08G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Golgi Protein 73 ELISA kit

E07G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Golgi Protein 73 ELISA kit

E07G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Golgi Protein 73 ELISA kit

E07G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Golgi Protein 73 ELISA kit

E09G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Golgi Protein 73 ELISA kit

E09G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Golgi Protein 73 ELISA kit

E09G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TGOLN2 cloning plasmid

CSB-CL023468HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1344
  • Sequence: atgcggttcgtggttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagaagctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg
  • Show more
Description: A cloning plasmid for the TGOLN2 gene.

TGOLN2 cloning plasmid

CSB-CL023468HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1314
  • Sequence: atgcggttcgtagttgccttggtcctcctgaacgtcgcagcggcgggagccgtgccgctcttggccaccgaaagcgtcaagcaagaagatgctggagtacggccttctgcaggaaacgtctccacccaccccagcttgagccaacggcctggaggctctaccaagtcgcatccgg
  • Show more
Description: A cloning plasmid for the TGOLN2 gene.

TGOLN2 Rabbit pAb

A16707-100ul 100 ul
EUR 308

TGOLN2 Rabbit pAb

A16707-200ul 200 ul
EUR 459

TGOLN2 Rabbit pAb

A16707-20ul 20 ul
EUR 183

TGOLN2 Rabbit pAb

A16707-50ul 50 ul
EUR 223

TGOLN2 Rabbit pAb

A8914-100ul 100 ul
EUR 308

TGOLN2 Rabbit pAb

A8914-200ul 200 ul
EUR 459

TGOLN2 Rabbit pAb

A8914-20ul 20 ul Ask for price

TGOLN2 Rabbit pAb

A8914-50ul 50 ul Ask for price

TGOLN2 Blocking Peptide

33R-7348 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGOLN2 antibody, catalog no. 70R-7394

TGOLN2 Polyclonal Antibody

29941-100ul 100ul
EUR 252

TGOLN2 Polyclonal Antibody

29941-50ul 50ul
EUR 187

Anti-TGOLN2 antibody

STJ111478 100 µl
EUR 277
Description: This gene encodes a type I integral membrane protein that is localized to the trans-Golgi network, a major sorting station for secretory and membrane proteins. The encoded protein cycles between early endosomes and the trans-Golgi network, and may play a role in exocytic vesicle formation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-TGOLN2 antibody

STJ119129 100 µl
EUR 277

Human Golgi Apparatus Protein 1 (GLG1) ELISA Kit

abx555387-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.

ELISA kit for Human Golgi apparatus protein 1

EK3366 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi apparatus protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Golgi membrane protein 1

EK3857 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi membrane protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GLG1/ Golgi apparatus protein 1 ELISA Kit

E1014Hu 1 Kit
EUR 605

Human GOLM1/ Golgi membrane protein 1 ELISA Kit

E1032Hu 1 Kit
EUR 571

Human GP-73(Golgi Protein 73) ELISA Kit

EH3162 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Alias: GP-73
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Golgi resident protein GCP60, ACBD3 ELISA KIT

ELI-12528h 96 Tests
EUR 824

Human Golgi membrane protein 1, GOLM1 ELISA KIT

ELI-05457h 96 Tests
EUR 824

ELISA kit for Human GP73 (Golgi Protein 73)

ELK2140 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Golgi Protein 73 (GP73). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Golgi Prot
  • Show more
Description: A sandwich ELISA kit for detection of Golgi Protein 73 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human golgi protein 73(GP-73)ELISA Kit

GA-E1449HM-48T 48T
EUR 289

Human golgi protein 73(GP-73)ELISA Kit

GA-E1449HM-96T 96T
EUR 466

Human Golgi apparatus protein 1, GLG1 ELISA KIT

ELI-39078h 96 Tests
EUR 824

Human Golgi Membrane Protein 1 (GOLM1) ELISA Kit

abx251193-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human golgi protein 73,GP-73 ELISA Kit

201-12-1433 96 tests
EUR 440
  • This golgi protein 73 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human golgi protein 73, GP-73 ELISA Kit

CSB-E11332h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human golgi protein 73, GP-73 ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human golgi protein 73, GP-73 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human golgi protein 73(GP-73)ELISA Kit

QY-E03381 96T
EUR 361

Mouse ERGIC And Golgi 2 (ERGIC2) ELISA Kit

abx389190-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Trans-2-aminocyclohexanol hydrochloride

  • EUR 217.00
  • EUR 746.00
  • EUR 342.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.

Potassium Trans-2-Methylcyclohexyltrifluoroborate

abx188856-100g 100 g
EUR 1386
  • Shipped within 1-2 weeks.

Trans-2-Phenylcyclopropylamine hydrochloride

M55000 250 mg
EUR 196.45
Description: The best epigenetics products

TGOLN2 ORF Vector (Human) (pORF)

ORF010473 1.0 ug DNA
EUR 95

TGOLN2 ORF Vector (Human) (pORF)

ORF010474 1.0 ug DNA
EUR 95

Human Peroxisomal trans- 2- enoyl- CoA reductase, PECR ELISA KIT

ELI-22081h 96 Tests
EUR 824

Human Peroxisomal trans-2-enoyl-CoA reductase (PECR) ELISA Kit

abx382149-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

TGOLN2 Protein Vector (Human) (pPB-C-His)

PV041889 500 ng
EUR 329

TGOLN2 Protein Vector (Human) (pPB-N-His)

PV041890 500 ng
EUR 329

TGOLN2 Protein Vector (Human) (pPM-C-HA)

PV041891 500 ng
EUR 329

TGOLN2 Protein Vector (Human) (pPM-C-His)

PV041892 500 ng
EUR 329

TGOLN2 Protein Vector (Human) (pPB-C-His)

PV041893 500 ng
EUR 329

TGOLN2 Protein Vector (Human) (pPB-N-His)

PV041894 500 ng
EUR 329

TGOLN2 Protein Vector (Human) (pPM-C-HA)

PV041895 500 ng
EUR 329

TGOLN2 Protein Vector (Human) (pPM-C-His)

PV041896 500 ng
EUR 329

Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit

E01C1881-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit

E01C1881-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Conserved oligomeric Golgi complex subunit 2(COG2) ELISA kit

E01C1881-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Conserved oligomeric Golgi complex subunit 2(COG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Golgi SNAP receptor complex member 2, GOSR2 ELISA KIT

ELI-27259h 96 Tests
EUR 824

Human Golgi SNAP Receptor Complex Member 2 (GOSR2) ELISA Kit

abx259601-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Component Of Oligomeric Golgi Complex 2 (COG2) ELISA Kit

abx384724-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pig Golgi Protein 73 (GP73) ELISA Kit

abx361254-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Golgi Protein 73 (GP73) ELISA Kit

abx363412-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea pig Golgi Protein 73 ELISA kit

E05G0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Golgi Protein 73 ELISA kit

E05G0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Golgi Protein 73 ELISA kit

E05G0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Golgi Protein 73 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Golgi Protein 73 (GP73) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Golgi Protein 73 (GP73) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Golgi Protein 73 (GP73) ELISA Kit

abx356107-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Golgi Protein 73 (GP73) ELISA Kit

abx359502-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Golgi Protein 73 (GP73) ELISA Kit

DLR-GP73-Mu-48T 48T
EUR 508
  • Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit

DLR-GP73-Mu-96T 96T
EUR 661
  • Should the Mouse Golgi Protein 73 (GP73) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit

SEB668Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit

SEB668Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit

SEB668Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit

SEB668Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Golgi Protein 73 (GP73) ELISA Kit

  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
  • GOLPH2
  • C9orf155
  • Golgi Membrane Protein 1
  • Golgi Phosphoprotein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Golgi Protein 73 (GP73) ELISA Kit

SEB668Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Rat Golgi Protein 73 (GP73) ELISA Kit

SEB668Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Rat Golgi Protein 73 (GP73) ELISA Kit

SEB668Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Rat Golgi Protein 73 (GP73) ELISA Kit

SEB668Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Golgi Protein 73 (GP73) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Golgi Protein 73 (GP73) in serum, plasma, tissue homogenates and other biological fluids.

Rat Golgi Protein 73 (GP73) ELISA Kit

  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Golgi Protein 73 elisa. Alternative names of the recognized antigen: GOLM1
  • GOLPH2
  • C9orf155
  • Golgi Membrane Protein 1
  • Golgi Phosphoprotein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Golgi Protein 73 (GP73) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Golgi Protein 73 ELISA Kit (GP73)

RK02859 96 Tests
EUR 521

Rat Golgi Protein 73 ELISA Kit (GP73)

RK03694 96 Tests
EUR 521

Mouse Golgi Protein 73 (GP73) ELISA Kit

RD-GP73-Mu-48Tests 48 Tests
EUR 511

Mouse Golgi Protein 73 (GP73) ELISA Kit

RD-GP73-Mu-96Tests 96 Tests
EUR 709

Mouse Golgi Protein 73 (GP73) ELISA Kit

RDR-GP73-Mu-48Tests 48 Tests
EUR 534

Mouse Golgi Protein 73 (GP73) ELISA Kit

RDR-GP73-Mu-96Tests 96 Tests
EUR 742

trans-trans Muconic acid

B7915-100 100 mg
EUR 108

trans-trans Muconic acid

B7915-500 500 mg
EUR 166

trans-trans-Muconic acid

HY-113247 100mg
EUR 108

Tgoln2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3377103 1.0 ug DNA
EUR 154

Human Golgi phosphoprotein 3 (GOLPH3) ELISA Kit

abx556004-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

ELISA kit for Human Golgi phosphoprotein 3

EK3275 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Golgi phosphoprotein 3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GOLPH3/ Golgi phosphoprotein 3 ELISA Kit

E1033Hu 1 Kit
EUR 605

Human Golgi phosphoprotein 3, GOLPH3 ELISA KIT

ELI-09745h 96 Tests
EUR 824

Human Golgi Glycoprotein 1 (GLG1)ELISA Kit

201-12-2724 96 tests
EUR 440
  • This Golgi Glycoprotein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Golgi Phosphoprotein 3 (GOLPH3)ELISA Kit

201-12-2725 96 tests
EUR 440
  • This Golgi Phosphoprotein 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Golgi Glycoprotein 1(GLG1)ELISA Kit

QY-E03379 96T
EUR 361

Human Golgi Phosphoprotein 3(GOLPH3)ELISA Kit

QY-E03380 96T
EUR 361

Human GORASP1(Golgi reassembly-stacking protein 1) ELISA Kit

EH8929 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9BQQ3
  • Alias: Golgi peripheral membrane protein p65/Golgi phosphoprotein 5/GOLPH5/Golgi reassembly-stacking protein of 65 kDa/GRASP65
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Golgi reassembly- stacking protein 1, GORASP1 ELISA KIT

ELI-27463h 96 Tests
EUR 824

Human Golgi integral membrane protein 4, GOLIM4 ELISA KIT

ELI-27934h 96 Tests
EUR 824

Human Golgi Reassembly Stacking Protein 1 (GORASP1) ELISA Kit

abx259607-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human GP-73 (Golgi Protein 73)

E-EL-H1313 1 plate of 96 wells
EUR 534
  • Gentaur's GP-73 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GP-73. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GP-73 (Golgi Protein 73) in samples from Serum, Plasma, Cell supernatant

Recombinant Human BD-2 Protein

PROTO15263-2 20ug
EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues.

Recombinant Human Relaxin-2 Protein

PROTP04090-2 25ug
EUR 317
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain.

Recombinant Human PAI-2 Protein

PROTP05120-2 10ug
EUR 317
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein.

Recombinant Human MMP-2 Protein

PROTP08253-2 10ug
EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids).

Recombinant Human TFF-2 Protein

PROTQ03403-2 20ug
EUR 317
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds.

BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer

PROTP12643-2 Regular: 20ug
EUR 317
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques.

GORASP2 Golgi Reassembly Stacking Protein 2 Human Recombinant Protein

PROTQ9H8Y8 Regular: 20ug
EUR 317
Description: GORASP2 Human Recombinant produced in E. coli is a single polypeptide chain containing 475 amino acids (1-452) and having a molecular mass of 49.5kDa.;GORASP2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Golgi Protein 73 (GP73) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

TGOLN2 Polyclonal Conjugated Antibody

C29941 100ul
EUR 397

Mouse TGOLN2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ELISA kit for Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR)

KTE61674-48T 48T
EUR 332
  • MECR (Mitochondrial Trans-2-Enoyl-CoA Reductase) is a Protein Coding gene. Among its related pathways are Fatty acid metabolism and Fatty acid elongation. GO annotations related to this gene include oxidoreductase activity and trans-2-enoyl-CoA
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR)

KTE61674-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MECR (Mitochondrial Trans-2-Enoyl-CoA Reductase) is a Protein Coding gene. Among its related pathways are Fatty acid metabolism and Fatty acid elongation. GO annotations related to this gene include oxidoreductase activity and trans-2-enoyl-CoA
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR)

KTE61674-96T 96T
EUR 539
  • MECR (Mitochondrial Trans-2-Enoyl-CoA Reductase) is a Protein Coding gene. Among its related pathways are Fatty acid metabolism and Fatty acid elongation. GO annotations related to this gene include oxidoreductase activity and trans-2-enoyl-CoA
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Trans-2-enoyl-CoA reductase, mitochondrial (MECR) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

IL-2 Interleukin-2 Human Recombinant Protein, His Tag

PROTP60568-2 Regular: 10ug
EUR 317
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_

Human TGOLN2(Trans Golgi Network Protein 2) ELISA Kit