Hudsen

Human brain gene expression atlas project

Human TNPO2(Transportin 2) ELISA Kit

Human TNPO2(Transportin 2) ELISA Kit

Human Transportin 2 (TNPO2) ELISA Kit

RD-TNPO2-Hu-48Tests 48 Tests
EUR 521

Human Transportin 2 (TNPO2) ELISA Kit

RD-TNPO2-Hu-96Tests 96 Tests
EUR 723

Human Transportin 2 (TNPO2) ELISA Kit

20-abx153382
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transportin 2 (TNPO2) ELISA Kit

abx253292-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human TNPO2(Transportin 2) ELISA Kit

EH3892 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O14787
  • Alias: TNPO2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Transportin- 2, TNPO2 ELISA KIT

ELI-28859h 96 Tests
EUR 824

Human Transportin 2(TNPO2)ELISA Kit

QY-E00083 96T
EUR 394

Human Transportin 2 (TNPO2) ELISA Kit

SED196Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transportin 2 (TNPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transportin 2 (TNPO2) in Tissue homogenates and other biological fluids.

Human Transportin 2 (TNPO2) ELISA Kit

SED196Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transportin 2 (TNPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transportin 2 (TNPO2) in Tissue homogenates and other biological fluids.

Human Transportin 2 (TNPO2) ELISA Kit

SED196Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transportin 2 (TNPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transportin 2 (TNPO2) in Tissue homogenates and other biological fluids.

Human Transportin 2 (TNPO2) ELISA Kit

SED196Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transportin 2 (TNPO2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transportin 2 (TNPO2) in Tissue homogenates and other biological fluids.

Human Transportin 2 (TNPO2) ELISA Kit

4-SED196Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transportin 2 elisa. Alternative names of the recognized antigen: IPO3
  • KPNB2B
  • TRN2
  • Importin 3
  • Karyopherin Beta 2b
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transportin 2 (TNPO2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Transportin- 2, Tnpo2 ELISA KIT

ELI-17009m 96 Tests
EUR 865

Monkey Transportin 2 (TNPO2) ELISA Kit

abx359378-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Transportin 2 (TNPO2) ELISA Kit

abx360929-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Transportin 2 (TNPO2) ELISA Kit

abx363018-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Transportin 2 (TNPO2) ELISA Kit

abx355941-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Transportin 2 (TNPO2) Antibody

20-abx128456
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transportin 2 (TNPO2) Antibody

20-abx174920
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transportin 2 (TNPO2) Antibody

abx238844-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Transportin 2 (TNPO2)

4-RPD196Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O14787
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Transportin 2 expressed in: E.coli

ELISA kit for Human TNPO2 (Transportin 2)

E-EL-H1510 1 plate of 96 wells
EUR 534
  • Gentaur's TNPO2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TNPO2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TNPO2 (Transportin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human TNPO2 (Transportin 2)

ELK4077 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transportin 2 (TNPO2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transportin
  • Show more
Description: A sandwich ELISA kit for detection of Transportin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Transportin-2 (TNPO2)

KTE60182-48T 48T
EUR 332
  • Transportin-2 (KPNB2) interacts directly and specifically with M9, the bidirectional transport signal of the nuclear shuttling protein hnRNPA1 and mediates hnRNPA1 nuclear import. In the course of isolating additional transportin-1 cDNAs, Siomi et al
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transportin-2 (TNPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transportin-2 (TNPO2)

KTE60182-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Transportin-2 (KPNB2) interacts directly and specifically with M9, the bidirectional transport signal of the nuclear shuttling protein hnRNPA1 and mediates hnRNPA1 nuclear import. In the course of isolating additional transportin-1 cDNAs, Siomi et al
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transportin-2 (TNPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transportin-2 (TNPO2)

KTE60182-96T 96T
EUR 539
  • Transportin-2 (KPNB2) interacts directly and specifically with M9, the bidirectional transport signal of the nuclear shuttling protein hnRNPA1 and mediates hnRNPA1 nuclear import. In the course of isolating additional transportin-1 cDNAs, Siomi et al
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transportin-2 (TNPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Transportin 2 (TNPO2) CLIA Kit

abx197839-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Transportin 2 (TNPO2) CLIA Kit

20-abx494137
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Transportin 2 (TNPO2) Protein

20-abx168145
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea pig Transportin 2 (TNPO2) ELISA Kit

abx357295-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Mouse Transportin-2 (TNPO2)

KTE70092-48T 48T
EUR 332
  • Transportin-2 (KPNB2) interacts directly and specifically with M9, the bidirectional transport signal of the nuclear shuttling protein hnRNPA1 and mediates hnRNPA1 nuclear import. In the course of isolating additional transportin-1 cDNAs, Siomi et al
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transportin-2 (TNPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transportin-2 (TNPO2)

KTE70092-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Transportin-2 (KPNB2) interacts directly and specifically with M9, the bidirectional transport signal of the nuclear shuttling protein hnRNPA1 and mediates hnRNPA1 nuclear import. In the course of isolating additional transportin-1 cDNAs, Siomi et al
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transportin-2 (TNPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transportin-2 (TNPO2)

KTE70092-96T 96T
EUR 539
  • Transportin-2 (KPNB2) interacts directly and specifically with M9, the bidirectional transport signal of the nuclear shuttling protein hnRNPA1 and mediates hnRNPA1 nuclear import. In the course of isolating additional transportin-1 cDNAs, Siomi et al
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transportin-2 (TNPO2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human TNPO2 (Transportin 2)

E-CL-H0971 1 plate of 96 wells
EUR 584
  • Gentaur's TNPO2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human TNPO2 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human TNPO2 (Transportin 2) in samples from Serum, Plasma, Cell supernatant

Transportin 2 (TNPO2) Polyclonal Antibody (Human)

4-PAD196Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNPO2 (Leu17~Leu248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transportin 2 (TNPO2)

Transportin 2 (TNPO2) Polyclonal Antibody (Human), APC

4-PAD196Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNPO2 (Leu17~Leu248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transportin 2 (TNPO2). This antibody is labeled with APC.

Transportin 2 (TNPO2) Polyclonal Antibody (Human), Biotinylated

4-PAD196Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNPO2 (Leu17~Leu248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transportin 2 (TNPO2). This antibody is labeled with Biotin.

Transportin 2 (TNPO2) Polyclonal Antibody (Human), Cy3

4-PAD196Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNPO2 (Leu17~Leu248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transportin 2 (TNPO2). This antibody is labeled with Cy3.

Transportin 2 (TNPO2) Polyclonal Antibody (Human), FITC

4-PAD196Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNPO2 (Leu17~Leu248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transportin 2 (TNPO2). This antibody is labeled with FITC.

Transportin 2 (TNPO2) Polyclonal Antibody (Human), HRP

4-PAD196Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNPO2 (Leu17~Leu248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transportin 2 (TNPO2). This antibody is labeled with HRP.

Transportin 2 (TNPO2) Polyclonal Antibody (Human), PE

4-PAD196Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNPO2 (Leu17~Leu248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transportin 2 (TNPO2). This antibody is labeled with PE.

Transportin 2 (TNPO2) Polyclonal Antibody (Human), APC-Cy7

4-PAD196Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNPO2 (Leu17~Leu248)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transportin 2 (TNPO2). This antibody is labeled with APC-Cy7.

TNPO2 ELISA KIT|Human

EF007218 96 Tests
EUR 689

TNPO2 ELISA Kit (Human) (OKCD01743)

OKCD01743 96 Wells
EUR 831
Description: Description of target: Probably functions in nuclear protein import as nuclear transport receptor. Serves as receptor for nuclear localization signals (NLS) in cargo substrates. Is thought to mediate docking of the importin/substrate complex to the nuclear pore complex (NPC) through binding to nucleoporin and the complex is subsequently translocated through the pore by an energy requiring, Ran-dependent mechanism. At the nucleoplasmic side of the NPC, Ran binds to the importin, the importin/substrate complex dissociates and importin is re-exported from the nucleus to the cytoplasm where GTP hydrolysis releases Ran. The directionality of nuclear import is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.121 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human Transportin 1 ELISA kit

E01T0254-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transportin 1 ELISA kit

E01T0254-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transportin 1 ELISA kit

E01T0254-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Transportin 2 antibody

70R-2016 50 ug
EUR 467
Description: Rabbit polyclonal Transportin 2 antibody

Transportin 2 antibody

70R-2301 50 ug
EUR 467
Description: Rabbit polyclonal Transportin 2 antibody

Human Transportin 1 (TNPO1) ELISA Kit

DLR-TNPO1-Hu-48T 48T
EUR 517
  • Should the Human Transportin 1 (TNPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transportin 1 (TNPO1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Transportin 1 (TNPO1) ELISA Kit

DLR-TNPO1-Hu-96T 96T
EUR 673
  • Should the Human Transportin 1 (TNPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transportin 1 (TNPO1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Transportin 1 (TNPO1) ELISA Kit

abx253291-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human TNPO1(Transportin 1) ELISA Kit

EH3891 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: Q92973
  • Alias: TNPO1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human Transportin- 1, TNPO1 ELISA KIT

ELI-16931h 96 Tests
EUR 824

Human Transportin- 3, TNPO3 ELISA KIT

ELI-45587h 96 Tests
EUR 824

Human Transportin 3(TNPO3)ELISA Kit

QY-E00082 96T
EUR 394

Human Transportin 1(TNPO1)ELISA Kit

QY-E00084 96T
EUR 394

Human Transportin 1 (TNPO1) ELISA Kit

RDR-TNPO1-Hu-48Tests 48 Tests
EUR 544

Human Transportin 1 (TNPO1) ELISA Kit

RDR-TNPO1-Hu-96Tests 96 Tests
EUR 756

Human Transportin 1 (TNPO1) ELISA Kit

RD-TNPO1-Hu-48Tests 48 Tests
EUR 521

Human Transportin 1 (TNPO1) ELISA Kit

RD-TNPO1-Hu-96Tests 96 Tests
EUR 723

Transportin 2 Blocking Peptide

33R-5534 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNPO2 antibody, catalog no. 70R-2016

Transportin 2 Blocking Peptide

33R-5883 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNPO2 antibody, catalog no. 70R-2301

Transportin 2 (TNOP2) Antibody

20-abx116253
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rat Transportin 1 ELISA kit

E02T0254-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transportin 1 ELISA kit

E02T0254-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transportin 1 ELISA kit

E02T0254-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transportin 1 ELISA kit

E04T0254-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transportin 1 ELISA kit

E04T0254-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transportin 1 ELISA kit

E04T0254-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transportin 1 ELISA kit

E03T0254-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transportin 1 ELISA kit

E03T0254-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transportin 1 ELISA kit

E03T0254-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transportin 1 ELISA kit

E08T0254-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transportin 1 ELISA kit

E08T0254-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transportin 1 ELISA kit

E08T0254-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transportin 1 ELISA kit

E07T0254-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transportin 1 ELISA kit

E07T0254-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transportin 1 ELISA kit

E07T0254-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transportin 1 ELISA kit

E09T0254-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transportin 1 ELISA kit

E09T0254-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transportin 1 ELISA kit

E09T0254-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transportin 1 ELISA kit

E06T0254-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transportin 1 ELISA kit

E06T0254-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transportin 1 ELISA kit

E06T0254-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TNPO2 antibody

70R-20910 50 ul
EUR 435
Description: Rabbit polyclonal TNPO2 antibody

TNPO2 Antibody

1-CSB-PA024021GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TNPO2. Recognizes TNPO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

TNPO2 siRNA

20-abx937690
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TNPO2 siRNA

20-abx937691
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TNPO2

YF-PA26101 50 ul
EUR 334
Description: Mouse polyclonal to TNPO2

ELISA kit for Human TNPO1 (Transportin 1)

E-EL-H2349 1 plate of 96 wells
EUR 534
  • Gentaur's TNPO1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TNPO1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TNPO1 (Transportin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Transportin-3 (TNPO3)

KTE60181-48T 48T
EUR 332
  • TNPO3 is a nuclear import receptor for serine/arginine-rich (SR) proteins, which are essential precursor-mRNA splicing factors.By yeast 2-hybrid analysis using the RS domain of the E2 protein of human papillomavirus (HPV)-5 as bait, Lai et al. (2000)
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transportin-3 (TNPO3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transportin-3 (TNPO3)

KTE60181-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TNPO3 is a nuclear import receptor for serine/arginine-rich (SR) proteins, which are essential precursor-mRNA splicing factors.By yeast 2-hybrid analysis using the RS domain of the E2 protein of human papillomavirus (HPV)-5 as bait, Lai et al. (2000)
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transportin-3 (TNPO3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transportin-3 (TNPO3)

KTE60181-96T 96T
EUR 539
  • TNPO3 is a nuclear import receptor for serine/arginine-rich (SR) proteins, which are essential precursor-mRNA splicing factors.By yeast 2-hybrid analysis using the RS domain of the E2 protein of human papillomavirus (HPV)-5 as bait, Lai et al. (2000)
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transportin-3 (TNPO3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transportin-1 (TNPO1)

KTE60183-48T 48T
EUR 332
  • Targeting of most nuclear proteins to the cell nucleus is initiated by interaction between the protein's nuclear localization signal (NLS) and the importin, or karyopherin, receptor complex. An importin heterodimer recognizes the NLS protein in the c
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transportin-1 (TNPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transportin-1 (TNPO1)

KTE60183-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Targeting of most nuclear proteins to the cell nucleus is initiated by interaction between the protein's nuclear localization signal (NLS) and the importin, or karyopherin, receptor complex. An importin heterodimer recognizes the NLS protein in the c
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transportin-1 (TNPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transportin-1 (TNPO1)

KTE60183-96T 96T
EUR 539
  • Targeting of most nuclear proteins to the cell nucleus is initiated by interaction between the protein's nuclear localization signal (NLS) and the importin, or karyopherin, receptor complex. An importin heterodimer recognizes the NLS protein in the c
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transportin-1 (TNPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TNPO2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2420403 1.0 ug DNA
EUR 154

Human TNPO2 shRNA Plasmid

20-abx959328
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Transportin 1 (TNPO1) ELISA Kit

DLR-TNPO1-Mu-48T 48T
EUR 527
  • Should the Mouse Transportin 1 (TNPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transportin 1 (TNPO1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Transportin 1 (TNPO1) ELISA Kit

DLR-TNPO1-Mu-96T 96T
EUR 688
  • Should the Mouse Transportin 1 (TNPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transportin 1 (TNPO1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Guinea pig Transportin 1 ELISA kit

E05T0254-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transportin 1 ELISA kit

E05T0254-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transportin 1 ELISA kit

E05T0254-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transportin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transportin 1 (TNPO1) ELISA Kit

abx254474-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Transportin- 3, Tnpo3 ELISA KIT

ELI-16475m 96 Tests
EUR 865

Bovine Transportin- 1, TNPO1 ELISA KIT

ELI-45586b 96 Tests
EUR 928

Monkey Transportin 1 (TNPO1) ELISA Kit

abx359934-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Transportin 1 (TNPO1) ELISA Kit

abx361705-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Transportin 1 (TNPO1) ELISA Kit

abx363234-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Transportin 1 (TNPO1) ELISA Kit

abx353994-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Chicken Transportin 1 (TNPO1) ELISA Kit

abx356678-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse TNPO1(Transportin 1) ELISA Kit

EM1415 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: Q8BFY9
  • Alias: TNPO1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.938 ng/ml

Mouse Transportin 1(TNPO1)ELISA Kit

GA-E0016MS-48T 48T
EUR 336

Mouse Transportin 1(TNPO1)ELISA Kit

GA-E0016MS-96T 96T
EUR 534

Mouse Transportin- 1, Tnpo1 ELISA KIT

ELI-40071m 96 Tests
EUR 865

Mouse Transportin 1 (TNPO1) ELISA Kit

RDR-TNPO1-Mu-48Tests 48 Tests
EUR 557

Mouse Transportin 1 (TNPO1) ELISA Kit

RDR-TNPO1-Mu-96Tests 96 Tests
EUR 774

Mouse Transportin 1 (TNPO1) ELISA Kit

RD-TNPO1-Mu-48Tests 48 Tests
EUR 533

Mouse Transportin 1 (TNPO1) ELISA Kit

RD-TNPO1-Mu-96Tests 96 Tests
EUR 740

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

TNPO1 ELISA Kit| Mouse Transportin 1 ELISA Kit

EF013940 96 Tests
EUR 689

Human Transportin 1 (TNPO1) CLIA Kit

abx197837-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Recombinant human Transportin-1

P2626 100ug Ask for price
  • Uniprot ID: Q8BFY9
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Transportin-1

TNPO2 cloning plasmid

CSB-CL024021HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2664
  • Sequence: atggactggcagccagacgagcagggcctgcagcaggtcctgcagctgctcaaagactcacagtcgcccaacacagccactcagcgcatcgtgcaggataaactcaaacaactcaatcagtttcctgacttcaacaactacctgattttcgtcctgaccagactcaagtcagaag
  • Show more
Description: A cloning plasmid for the TNPO2 gene.

anti- TNPO2 antibody

FNab08844 100µg
EUR 548.75
  • Immunogen: transportin 2
  • Uniprot ID: O14787
  • Gene ID: 30000
  • Research Area: Signal Transduction
Description: Antibody raised against TNPO2

Anti-TNPO2 antibody

PAab08844 100 ug
EUR 386

pDONR223-TNPO2 Plasmid

PVTB00389 2 ug
EUR 356

TNPO2 ORF Vector (Human) (pORF)

ORF010836 1.0 ug DNA
EUR 95

ELISA kit for Mouse TNPO1 (Transportin 1)

E-EL-M1197 1 plate of 96 wells
EUR 534
  • Gentaur's TNPO1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse TNPO1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse TNPO1 (Transportin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat TNPO1 (Transportin 1)

E-EL-R1021 1 plate of 96 wells
EUR 534
  • Gentaur's TNPO1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat TNPO1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat TNPO1 (Transportin 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Bovine Transportin-1 (TNPO1)

KTE10017-48T 48T
EUR 354
  • Targeting of most nuclear proteins to the cell nucleus is initiated by interaction between the protein's nuclear localization signal (NLS) and the importin, or karyopherin, receptor complex. An importin heterodimer recognizes the NLS protein in the c
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transportin-1 (TNPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transportin-1 (TNPO1)

KTE10017-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Targeting of most nuclear proteins to the cell nucleus is initiated by interaction between the protein's nuclear localization signal (NLS) and the importin, or karyopherin, receptor complex. An importin heterodimer recognizes the NLS protein in the c
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transportin-1 (TNPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transportin-1 (TNPO1)

KTE10017-96T 96T
EUR 572
  • Targeting of most nuclear proteins to the cell nucleus is initiated by interaction between the protein's nuclear localization signal (NLS) and the importin, or karyopherin, receptor complex. An importin heterodimer recognizes the NLS protein in the c
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transportin-1 (TNPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transportin-3 (TNPO3)

KTE70091-48T 48T
EUR 332
  • TNPO3 is a nuclear import receptor for serine/arginine-rich (SR) proteins, which are essential precursor-mRNA splicing factors.By yeast 2-hybrid analysis using the RS domain of the E2 protein of human papillomavirus (HPV)-5 as bait, Lai et al. (2000)
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transportin-3 (TNPO3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transportin-3 (TNPO3)

KTE70091-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TNPO3 is a nuclear import receptor for serine/arginine-rich (SR) proteins, which are essential precursor-mRNA splicing factors.By yeast 2-hybrid analysis using the RS domain of the E2 protein of human papillomavirus (HPV)-5 as bait, Lai et al. (2000)
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transportin-3 (TNPO3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transportin-3 (TNPO3)

KTE70091-96T 96T
EUR 539
  • TNPO3 is a nuclear import receptor for serine/arginine-rich (SR) proteins, which are essential precursor-mRNA splicing factors.By yeast 2-hybrid analysis using the RS domain of the E2 protein of human papillomavirus (HPV)-5 as bait, Lai et al. (2000)
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transportin-3 (TNPO3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transportin-1 (TNPO1)

KTE70093-48T 48T
EUR 332
  • Targeting of most nuclear proteins to the cell nucleus is initiated by interaction between the protein's nuclear localization signal (NLS) and the importin, or karyopherin, receptor complex. An importin heterodimer recognizes the NLS protein in the c
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transportin-1 (TNPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transportin-1 (TNPO1)

KTE70093-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Targeting of most nuclear proteins to the cell nucleus is initiated by interaction between the protein's nuclear localization signal (NLS) and the importin, or karyopherin, receptor complex. An importin heterodimer recognizes the NLS protein in the c
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transportin-1 (TNPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transportin-1 (TNPO1)

KTE70093-96T 96T
EUR 539
  • Targeting of most nuclear proteins to the cell nucleus is initiated by interaction between the protein's nuclear localization signal (NLS) and the importin, or karyopherin, receptor complex. An importin heterodimer recognizes the NLS protein in the c
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transportin-1 (TNPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tnpo2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6352903 1.0 ug DNA
EUR 154

Tnpo2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4560803 1.0 ug DNA
EUR 154

anti-Transportin 1

YF-PA24058 50 ul
EUR 334
Description: Mouse polyclonal to Transportin 1

CLIA kit for Human TNPO1 (Transportin 1)

E-CL-H1370 1 plate of 96 wells
EUR 584
  • Gentaur's TNPO1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human TNPO1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human TNPO1 (Transportin 1) in samples from Serum, Plasma, Cell supernatant

Human Transportin 1 (TNPO1) Protein

20-abx069451
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse TNPO2 shRNA Plasmid

20-abx980781
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

TNPO2 sgRNA CRISPR Lentivector set (Human)

K2420401 3 x 1.0 ug
EUR 339

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse Transportin 1 (TNPO1) CLIA Kit

abx197838-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Transportin-3 (TNPO3) Antibody

abx219045-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Transportin 1 (TNPO1) Antibody

20-abx211672
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transportin 1 (TNPO1) Antibody

20-abx211673
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transportin 1 (TNPO1) Antibody

20-abx101247
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transportin 1 (TNPO1) Antibody

20-abx101248
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transportin 1 (TNPO1) Antibody

20-abx101249
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Transportin 1 (TNPO1) Antibody

20-abx116252
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transportin 1 (TNPO1) Antibody

20-abx124108
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transportin 1 (TNPO1) Antibody

20-abx174919
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transportin 1 (TNPO1) Antibody

abx030961-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Transportin 1 (TNPO1) Antibody

abx030961-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Transportin-1 (TNOP1) Antibody

abx238940-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Transportin-3 (TNPO3) Antibody

20-abx301108
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti- Transportin-1 antibody

FNab08940 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • Immunogen: transportin 1
  • Uniprot ID: Q92973
  • Research Area: Neuroscience
Description: Antibody raised against Transportin-1

Anti-Transportin-1 antibody

PAab08940 100 ug
EUR 412

Recombinant Transportin 1 (TNPO1)

4-RPA272Bo01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3SYU7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Transportin 1 expressed in: E.coli

Recombinant Transportin 1 (TNPO1)

4-RPA272Hu01
  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92973
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Transportin 1 expressed in: E.coli

Recombinant Transportin 1 (TNPO1)

4-RPA272Mu01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8BFY9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.3kDa
  • Isoelectric Point: 5.6
Description: Recombinant Mouse Transportin 1 expressed in: E.coli

Anti-Transportin 1 (3G2)

YF-MA13934 100 ug
EUR 363
Description: Mouse monoclonal to Transportin 1

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Tnpo2 ORF Vector (Rat) (pORF)

ORF078059 1.0 ug DNA
EUR 506

Tnpo2 ORF Vector (Mouse) (pORF)

ORF060150 1.0 ug DNA
EUR 506

Tnpo2 ORF Vector (Mouse) (pORF)

ORF060151 1.0 ug DNA
EUR 506

TNPO2 sgRNA CRISPR Lentivector (Human) (Target 1)

K2420402 1.0 ug DNA
EUR 154

TNPO2 sgRNA CRISPR Lentivector (Human) (Target 3)

K2420404 1.0 ug DNA
EUR 154

TNPO2 Protein Vector (Human) (pPB-C-His)

PV043341 500 ng
EUR 329

TNPO2 Protein Vector (Human) (pPB-N-His)

PV043342 500 ng
EUR 329

TNPO2 Protein Vector (Human) (pPM-C-HA)

PV043343 500 ng
EUR 329

TNPO2 Protein Vector (Human) (pPM-C-His)

PV043344 500 ng
EUR 329

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Human Fibrinogen (FBG) AssayMax ELISA Kit

EF1040-2 96 Well Plate
EUR 396

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

TNPO2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2420407 1.0 ug DNA
EUR 167

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

CLIA kit for Mouse TNPO1 (Transportin 1)

E-CL-M0663 1 plate of 96 wells
EUR 584
  • Gentaur's TNPO1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse TNPO1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse TNPO1 (Transportin 1) in samples from Serum, Plasma, Cell supernatant

Dr. P Kit-Solution 2

K2021010-2 6 ml
EUR 120
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Human TNPO2(Transportin 2) ELISA Kit