Hudsen

Human brain gene expression atlas project

Human TPMT(Thiopurine Methyltransferase) ELISA Kit

Human TPMT(Thiopurine Methyltransferase) ELISA Kit

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

RDR-TPMT-Hu-48Tests 48 Tests
EUR 544

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

RDR-TPMT-Hu-96Tests 96 Tests
EUR 756

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

RD-TPMT-Hu-48Tests 48 Tests
EUR 521

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

RD-TPMT-Hu-96Tests 96 Tests
EUR 723

Human Thiopurine Methyltransferase(TPMT)

QY-E05339 96T
EUR 374

Human Thiopurine Methyltransferase ELISA Kit (TPMT)

RK02435 96 Tests
EUR 521

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

SEC821Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

SEC821Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

SEC821Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

SEC821Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thiopurine Methyltransferase (TPMT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thiopurine Methyltransferase (TPMT) in serum, plasma and other biological fluids.

Human Thiopurine Methyltransferase (TPMT) ELISA Kit

4-SEC821Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thiopurine Methyltransferase elisa. Alternative names of the recognized antigen: Thiopurine S Methyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thiopurine Methyltransferase (TPMT) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Thiopurine Methyltransferase (TPMT) Antibody

20-abx128186
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Thiopurine Methyltransferase (TPMT) Antibody

20-abx174750
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Thiopurine Methyltransferase (TPMT)

4-RPC821Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51580
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.9kDa
  • Isoelectric Point: 6.7
Description: Recombinant Human Thiopurine Methyltransferase expressed in: E.coli

Human Thiopurine S-methyltransferase (TPMT)

1-CSB-RP005854h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Thiopurine S-methyltransferase(TPMT),partial expressed in E.coli

Human Thiopurine Methyltransferase (TPMT) Protein

20-abx166738
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Thiopurine Methyltransferase (TPMT) CLIA Kit

20-abx493913
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit

20-abx153363
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit

abx250428-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human TPMT/ Thiopurine S-methyltransferase ELISA Kit

E2576Hu 1 Kit
EUR 605

Human TPMT(Thiopurine S-methyltransferase) ELISA Kit

EH1175 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Uniprot ID: P51580
  • Alias: TPMT(Thiopurine S-methyltransferase)/Thiopurine methyltransferase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

Human Thiopurine S- methyltransferase, TPMT ELISA KIT

ELI-03368h 96 Tests
EUR 824

ELISA kit for Human TPMT (Thiopurine Methyltransferase)

ELK4063 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thiopurine Methyltransferase (TPMT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
  • Show more
Description: A sandwich ELISA kit for detection of Thiopurine Methyltransferase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human thiopurine S-methyltransferase (TPMT) ELISA kit

CSB-E17858h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human thiopurine S-methyltransferase (TPMT) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human thiopurine S-methyltransferase (TPMT) ELISA kit

1-CSB-E17858h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human thiopurine S-methyltransferase (TPMT) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Thiopurine S-Methyltransferase (TPMT) ELISA Kit

abx573967-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx110262
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx116062
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx137256
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx141576
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

abx238893-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Thiopurine S-Methyltransferase (TPMT) Antibody

20-abx000960
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rat Tpmt/ Thiopurine S-methyltransferase ELISA Kit

E1001Ra 1 Kit
EUR 646

Mouse Tpmt/ Thiopurine S-methyltransferase ELISA Kit

E1521Mo 1 Kit
EUR 632

Rat Thiopurine S- methyltransferase, Tpmt ELISA KIT

ELI-03369r 96 Tests
EUR 886

Mouse Thiopurine S- methyltransferase, Tpmt ELISA KIT

ELI-03370m 96 Tests
EUR 865

Bovine Thiopurine S- methyltransferase, TPMT ELISA KIT

ELI-03371b 96 Tests
EUR 928

Canine Thiopurine S-methyltransferase, TPMT ELISA KIT

ELI-03372d 96 Tests
EUR 928

Rabbit Thiopurine S- methyltransferase, TPMT ELISA KIT

ELI-03373Ra 96 Tests
EUR 928

Cow Thiopurine S-Methyltransferase (TPMT) ELISA Kit

20-abx514841
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Dog Thiopurine S-Methyltransferase (TPMT) ELISA Kit

20-abx514842
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Thiopurine S-Methyltransferase (TPMT) ELISA Kit

abx514844-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Thiopurine S-Methyltransferase (TPMT) ELISA Kit

abx514845-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Human Thiopurine S-methyltransferase (TPMT)

KTE60148-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thiopurine S-methyltransferase (TPMT)

KTE60148-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Thiopurine S-methyltransferase (TPMT)

KTE60148-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Thiopurine S-methyltransferase (TPMT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human TPMT (Thiopurine S-Methyltransferase)  Kit

E-EL-H5563 1 plate of 96 wells
EUR 534
  • Gentaur's TPMT ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TPMT. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TPMT (Thiopurine S-Methyltransferase)  Kit in samples from Serum, Plasma, Cell supernatant

Thiopurine S-Methyltransferase (TPMT) Antibody Pair

abx117377-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Tpmt ELISA Kit| Rat Thiopurine S-methyltransferase ELISA Kit

EF019410 96 Tests
EUR 689

Tpmt ELISA Kit| Mouse Thiopurine S-methyltransferase ELISA Kit

EF016373 96 Tests
EUR 689

TPMT ELISA Kit| Bovine Thiopurine S-methyltransferase ELISA Kit

EF011970 96 Tests
EUR 689

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse)

4-PAC821Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT)

TPMT Thiopurine S-methyltransferase Human Recombinant Protein

PROTP51580 Regular: 20ug
EUR 317
Description: TPMT Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 245 amino acids (1-245) and having a molecular mass of 28 kDa. ;Thiopurine S-methyltransferase is purified by proprietary chromatographic techniques.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), APC

4-PAC821Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with APC.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAC821Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with Biotin.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), Cy3

4-PAC821Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with Cy3.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), FITC

4-PAC821Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with FITC.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), HRP

4-PAC821Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with HRP.

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), PE

4-PAC821Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with PE.

Monoclonal Anti-Human Thiopurine S-methyltransferase (TPMT) protein IgG

AB-22123 5 ug
EUR 164

Thiopurine Methyltransferase (TPMT) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAC821Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPMT (Leu26~His227)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Thiopurine Methyltransferase (TPMT). This antibody is labeled with APC-Cy7.

Recombinant (E.Coli) Human Thiopurine S-methyltransferase (TPMT, 1-245 aa) protein

RP-712 5 ug
EUR 164

ELISA kit for Human Thiopurine S-methyltransferase

EK2628 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Thiopurine S-methyltransferase in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Thiopurine S-methyltransferase

7-04195 5µg Ask for price

Recombinant Human Thiopurine S-methyltransferase

7-04196 20µg Ask for price

Recombinant Human Thiopurine S-methyltransferase

7-04197 1mg Ask for price

Thiopurine S-methyltransferase Polyclonal Antibody

42134-100ul 100ul
EUR 333

Thiopurine S-methyltransferase Antibody (Biotin)

20-abx105972
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiopurine S-methyltransferase Antibody (FITC)

20-abx107387
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiopurine S-methyltransferase Antibody (HRP)

20-abx108807
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Thiopurine S-methyltransferase Protein (Recombinant)

20-abx073594
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Thiopurine S-methyltransferase Polyclonal Conjugated Antibody

C42134 100ul
EUR 397

TPMT ELISA KIT|Human

EF002391 96 Tests
EUR 689

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-100ug

QP8325-ec-100ug 100ug
EUR 408

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-10ug

QP8325-ec-10ug 10ug
EUR 200

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-1mg

QP8325-ec-1mg 1mg
EUR 1632

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-200ug

QP8325-ec-200ug 200ug
EUR 634

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-500ug

QP8325-ec-500ug 500ug
EUR 1060

Recombinant Human Thiopurine S-methyltransferase Protein, GST, E.coli-50ug

QP8325-ec-50ug 50ug
EUR 263

TPMT ELISA Kit (Human) (OKAN05537)

OKAN05537 96 Wells
EUR 792
Description: Description of target: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.127 ng/mL

TPMT ELISA Kit (Human) (OKCD08261)

OKCD08261 96 Wells
EUR 975
Description: Description of target: Recombinant Human Thiopurine S-methyltransferase;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL

TPMT ELISA Kit (Bovine) (OKEH07597)

OKEH07597 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

TPMT ELISA Kit (Dog) (OKEH07598)

OKEH07598 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Human TPMT Antibody

32795-05111 150 ug
EUR 261

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

TPMT ELISA Kit (Human) : 96 Wells (OKEH02086)

OKEH02086 96 Wells
EUR 662
Description: Description of target: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals, causing thiopurine S-methyltransferase deficiency. Related pseudogenes have been identified on chromosomes 3, 18 and X.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.33 ng/mL

TPMT protein

30R-1110 100 ug
EUR 397
Description: Purified recombinant Human TPMT protein

TPMT antibody

70R-20939 50 ul
EUR 435
Description: Rabbit polyclonal TPMT antibody

TPMT antibody

70R-15216 100 ug
EUR 327
Description: Rabbit polyclonal TPMT antibody

TPMT Antibody

32120-100ul 100ul
EUR 252

TPMT antibody

10R-3130 100 ul
EUR 322
Description: Mouse monoclonal NANS antibody

TPMT antibody

10R-6122 100 ul
EUR 691
Description: Mouse monoclonal TPMT antibody

TPMT antibody

10R-6123 100 ul
EUR 691
Description: Mouse monoclonal TPMT antibody

TPMT antibody

10R-6124 100 ul
EUR 726
Description: Mouse monoclonal TPMT antibody

TPMT antibody

10R-6125 100 ul
EUR 691
Description: Mouse monoclonal TPMT antibody

TPMT Antibody

1-CSB-PA00585A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

TPMT Antibody

DF6183 200ul
EUR 304
Description: TPMT Antibody detects endogenous levels of total TPMT.

TPMT Antibody

1-CSB-PA024110GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TPMT. Recognizes TPMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TPMT siRNA

20-abx905752
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPMT siRNA

20-abx937849
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPMT siRNA

20-abx937850
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TPMT Antibody

ABD6183 100 ug
EUR 438

anti-TPMT

YF-PA24886 50 ul
EUR 334
Description: Mouse polyclonal to TPMT

Human TPMT shRNA Plasmid

20-abx954923
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TPMT Recombinant Protein (Human)

RP032677 100 ug Ask for price

TPMT Recombinant Protein (Human)

RP032680 100 ug Ask for price

TPMT Rabbit pAb

A1017-100ul 100 ul
EUR 308

TPMT Rabbit pAb

A1017-200ul 200 ul
EUR 459

TPMT Rabbit pAb

A1017-20ul 20 ul
EUR 183

TPMT Rabbit pAb

A1017-50ul 50 ul
EUR 223

TPMT Rabbit pAb

A14067-100ul 100 ul
EUR 308

TPMT Rabbit pAb

A14067-200ul 200 ul
EUR 459

TPMT Rabbit pAb

A14067-20ul 20 ul
EUR 183

TPMT Rabbit pAb

A14067-50ul 50 ul
EUR 223

TPMT antibody (HRP)

60R-1492 100 ug
EUR 327
Description: Rabbit polyclonal TPMT antibody (HRP)

TPMT antibody (FITC)

60R-1493 100 ug
EUR 327
Description: Rabbit polyclonal TPMT antibody (FITC)

TPMT antibody (biotin)

60R-1494 100 ug
EUR 327
Description: Rabbit polyclonal TPMT antibody (biotin)

Polyclonal TPMT Antibody

APR10523G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TPMT . This antibody is tested and proven to work in the following applications:

TPMT Blocking Peptide

DF6183-BP 1mg
EUR 195

Anti-TPMT Antibody

A00671-1 100ug/vial
EUR 294

TPMT Conjugated Antibody

C32120 100ul
EUR 397

TPMT cloning plasmid

CSB-CL024110HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 738
  • Sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaagg
  • Show more
Description: A cloning plasmid for the TPMT gene.

TPMT cloning plasmid

CSB-CL024110HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 738
  • Sequence: atggatggtacaagaacttcacttgacattgaagagtactcggatactgaggtacagaaaaaccaagtactaactctggaagaatggcaagacaagtgggtgaacggcaagactgcttttcatcaggaacaaggacatcagctattaaagaagcatttagatactttccttaaagg
  • Show more
Description: A cloning plasmid for the TPMT gene.

TPMT Polyclonal Antibody

A51617 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- TPMT antibody

FNab08893 100µg
EUR 548.75
  • Immunogen: thiopurine S-methyltransferase
  • Uniprot ID: P51580
  • Gene ID: 7172
  • Research Area: Metabolism
Description: Antibody raised against TPMT

Anti-TPMT antibody

PAab08893 100 ug
EUR 386

Human TPMT(Thiopurine Methyltransferase) ELISA Kit