Human XPO5(Exportin 5) ELISA Kit
Human Exportin 5 (XPO5) ELISA Kit |
RD-XPO5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Exportin 5 (XPO5) ELISA Kit |
20-abx151460 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Exportin 5 (XPO5) ELISA Kit |
SEF160Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids. |
Human Exportin 5 (XPO5) ELISA Kit |
SEF160Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids. |
Human Exportin 5 (XPO5) ELISA Kit |
SEF160Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids. |
Human Exportin 5 (XPO5) ELISA Kit |
SEF160Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids. |
Human Exportin 5 (XPO5) ELISA Kit |
4-SEF160Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Exportin 5 elisa. Alternative names of the recognized antigen: RANBP21
- Exp5
- Ran-binding protein 21
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exportin 5 (XPO5) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Exportin 5 (XPO5) Antibody |
20-abx005208 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Exportin 5 (XPO5) Antibody |
20-abx131534 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Exportin 5 (XPO5) Antibody |
20-abx141913 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Exportin 5 (XPO5) Antibody |
20-abx172312 |
Abbexa |
|
|
|
Exportin 5 (XPO5) Antibody |
abx028558-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Exportin 5 (XPO5) Antibody |
abx028558-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Recombinant Exportin 5 (XPO5) |
4-RPF160Hu01 |
Cloud-Clone |
-
EUR 422.56
-
EUR 216.00
-
EUR 1309.60
-
EUR 503.20
-
EUR 906.40
-
EUR 346.00
-
EUR 3124.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9HAV4
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Exportin 5 expressed in: E.coli |
Human Exportin 5 (XPO5) Protein |
20-abx650642 |
Abbexa |
-
EUR 592.00
-
EUR 258.00
-
EUR 1776.00
-
EUR 704.00
-
EUR 439.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Exportin 5 (XPO5) CLIA Kit |
20-abx494803 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human XPO5 (Exportin 5) |
ELK3681 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exportin 5 (XPO5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exportin 5 (XPO5
- Show more
|
Description: A sandwich ELISA kit for detection of Exportin 5 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Exportin-5 (XPO5) |
KTE60011-48T |
Abbkine |
48T |
EUR 332 |
- Exportin-5 belongs to a large family of karyopherins that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments. The deduced 1,205-amino acid protein has a calculated molecular mass of about 136 kD. XPO5 a
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Exportin-5 (XPO5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Exportin-5 (XPO5) |
KTE60011-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Exportin-5 belongs to a large family of karyopherins that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments. The deduced 1,205-amino acid protein has a calculated molecular mass of about 136 kD. XPO5 a
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Exportin-5 (XPO5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Exportin-5 (XPO5) |
KTE60011-96T |
Abbkine |
96T |
EUR 539 |
- Exportin-5 belongs to a large family of karyopherins that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments. The deduced 1,205-amino acid protein has a calculated molecular mass of about 136 kD. XPO5 a
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Exportin-5 (XPO5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Anti-Exportin-5/XPO5 Antibody |
A02900 |
BosterBio |
100ug/vial |
EUR 294 |
Exportin 5 (XPO5) Polyclonal Antibody (Human) |
4-PAF160Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: XPO5 (Ala2~Gln180)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5) |
Exportin 5 (XPO5) Polyclonal Antibody (Human), APC |
4-PAF160Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: XPO5 (Ala2~Gln180)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with APC. |
Exportin 5 (XPO5) Polyclonal Antibody (Human), Biotinylated |
4-PAF160Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: XPO5 (Ala2~Gln180)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with Biotin. |
Exportin 5 (XPO5) Polyclonal Antibody (Human), Cy3 |
4-PAF160Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: XPO5 (Ala2~Gln180)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with Cy3. |
Exportin 5 (XPO5) Polyclonal Antibody (Human), FITC |
4-PAF160Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: XPO5 (Ala2~Gln180)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with FITC. |
Exportin 5 (XPO5) Polyclonal Antibody (Human), HRP |
4-PAF160Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: XPO5 (Ala2~Gln180)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with HRP. |
Exportin 5 (XPO5) Polyclonal Antibody (Human), PE |
4-PAF160Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: XPO5 (Ala2~Gln180)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with PE. |
Exportin 5 (XPO5) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF160Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: XPO5 (Ala2~Gln180)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with APC-Cy7. |
Exportin-5 Antibody |
49981-100ul |
SAB |
100ul |
EUR 333 |
Exportin-5 Antibody |
49981-50ul |
SAB |
50ul |
EUR 239 |
anti-Exportin-5 |
YF-PA20209 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Exportin-5 |
anti-Exportin-5 |
YF-PA20210 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Exportin-5 |
anti-Exportin-5 |
YF-PA26482 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Exportin-5 |
Exportin-5 Conjugated Antibody |
C49981 |
SAB |
100ul |
EUR 397 |
Exportin 5 Rabbit mAb |
A3813-100ul |
Abclonal |
100 ul |
EUR 410 |
Exportin 5 Rabbit mAb |
A3813-200ul |
Abclonal |
200 ul |
EUR 571 |
Exportin 5 Rabbit mAb |
A3813-20ul |
Abclonal |
20 ul |
EUR 221 |
Exportin 5 Rabbit mAb |
A3813-50ul |
Abclonal |
50 ul |
EUR 287 |
XPO5 ELISA Kit (Human) (OKCD00958) |
OKCD00958 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Mediates the nuclear export of proteins bearing a double-stranded RNA binding domain (dsRBD) and double-stranded RNAs (cargos). XPO5 in the nucleus binds cooperatively to the RNA and to the GTPase Ran in its active GTP-bound form. Proteins containing dsRBDs can associate with this trimeric complex through the RNA. Docking of this complex to the nuclear pore complex (NPC) is mediated through binding to nucleoporins. Upon transit of a nuclear export complex into the cytoplasm, hydrolysis of Ran-GTP to Ran-GDP (induced by RANBP1 and RANGAP1, respectively) cause disassembly of the complex and release of the cargo from the export receptor. XPO5 then returns to the nuclear compartment by diffusion through the nuclear pore complex, to mediate another round of transport. The directionality of nuclear export is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus. Overexpression may in some circumstances enhance RNA-mediated gene silencing (RNAi). Mediates nuclear export of isoform 5 of ADAR/ADAR1 in a RanGTP-dependent manner. Mediates the nuclear export of micro-RNA precursors, which form short hairpins. Also mediates the nuclear export of synthetic short hairpin RNAs used for RNA interference, and adenovirus VA1 dsRNA. In some circumstances can also mediate the nuclear export of deacylated and aminoacylated tRNAs. Specifically recognizes dsRNAs that lack a 5'-overhang in a sequence-independent manner, have only a short 3'-overhang, and that have a double-stranded length of at least 15 base-pairs. Binding is dependent on Ran-GTP. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL |
anti-Exportin-5 (2C5-1B3) |
LF-MA10381 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to Exportin-5 |
Anti-Exportin-5 (2C5-1B3) |
YF-MA19064 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to Exportin-5 |
Human Exportin 1 (XPO1)ELISA Kit |
201-12-2695 |
SunredBio |
96 tests |
EUR 440 |
- This Exportin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Exportin 1 (XPO1) ELISA Kit |
DLR-XPO1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Exportin 1 (XPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Exportin 1 (XPO1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Exportin 1 (XPO1) ELISA Kit |
DLR-XPO1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Exportin 1 (XPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Exportin 1 (XPO1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Exportin-4(XPO4) ELISA kit |
CSB-EL026222HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Exportin-4 (XPO4) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Exportin-4(XPO4) ELISA kit |
1-CSB-EL026222HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Exportin-4(XPO4) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Exportin 1 (XPO1) ELISA Kit |
20-abx151459 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Exportin-6 (XPO6) ELISA Kit |
abx384332-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Exportin-7 (XPO7) ELISA Kit |
abx384333-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Exportin 1 (XPO1) ELISA Kit |
RDR-XPO1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Exportin 1 (XPO1) ELISA Kit |
RDR-XPO1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Exportin 1 ELISA Kit (XPO1) |
RK02534 |
Abclonal |
96 Tests |
EUR 521 |
Human Exportin 1 (XPO1) ELISA Kit |
RD-XPO1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Exportin 1 (XPO1) ELISA Kit |
RD-XPO1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Exportin 1 (XPO1) ELISA Kit |
SEC258Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Exportin 1 (XPO1) ELISA Kit |
SEC258Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Exportin 1 (XPO1) ELISA Kit |
SEC258Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Exportin 1 (XPO1) ELISA Kit |
SEC258Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids. |
Human Exportin 1 (XPO1) ELISA Kit |
4-SEC258Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Exportin 1 elisa. Alternative names of the recognized antigen: Exp1
- CRM1 Homolog, Yeast
- Chromosome region maintenance 1 protein homolog
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exportin 1 (XPO1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
ELISA kit for Human XPO1 (Exportin 1) |
ELK4663 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exportin 1 (XPO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exportin 1 (XPO1
- Show more
|
Description: A sandwich ELISA kit for detection of Exportin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Exportin-1 (XPO1) |
KTE60012-48T |
Abbkine |
48T |
EUR 332 |
- Exportin-1 mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localiza
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Exportin-1 (XPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Exportin-1 (XPO1) |
KTE60012-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Exportin-1 mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localiza
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Exportin-1 (XPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Exportin-1 (XPO1) |
KTE60012-96T |
Abbkine |
96T |
EUR 539 |
- Exportin-1 mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localiza
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Exportin-1 (XPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
XPO5 antibody |
39182-100ul |
SAB |
100ul |
EUR 252 |
XPO5 antibody |
70R-8741 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal XPO5 antibody |
XPO5 antibody |
70R-8742 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal XPO5 antibody |
XPO5 antibody |
70R-8743 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal XPO5 antibody |
XPO5 siRNA |
20-abx940015 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
XPO5 siRNA |
20-abx940016 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
5-Formylcytosine (5-fC) ELISA Kit |
MET-5102-5 |
Cell Biolabs |
5 x 96 assays |
EUR 2283 |
5-Carboxylcytosine (5-caC) ELISA Kit |
MET-5103-5 |
Cell Biolabs |
5 x 96 assays |
EUR 2283 |
Rat Exportin-1 (Xpo1) ELISA Kit |
abx391307-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Exportin-1 (Xpo1) ELISA Kit |
abx389230-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human XPO5 shRNA Plasmid |
20-abx961495 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Exportin-2 (CSE1L) |
1-CSB-CF006042HU |
Cusabio |
-
EUR 965.00
-
EUR 665.00
-
EUR 715.00
|
|
- MW: 39.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Exportin-2(CSE1L),partial expressed in in vitro E.coli expression system |
Human Exportin 1 (XPO1) CLIA Kit |
20-abx493572 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
XPO5 Blocking Peptide |
33R-5489 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of XPO5 antibody, catalog no. 70R-8742 |
XPO5 Blocking Peptide |
33R-10360 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Xpo5 antibody, catalog no. 70R-8741 |
XPO5 Blocking Peptide |
33R-5948 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of XPO5 antibody, catalog no. 70R-8743 |
XPO5 Conjugated Antibody |
C39182 |
SAB |
100ul |
EUR 397 |
XPO5 cloning plasmid |
CSB-CL864014HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 843
- Sequence: atgaggctttctcagaaatggcaagttatcaaccaaaggagcctgctgtgtggagaagatgaggctgcagatgaaaacccagagtctcaagagatgctggaggagcaactggtgaggatgttaacccgagaagtcatggacctaatcacggtttgctgtgtttcaaagaagggtgc
- Show more
|
Description: A cloning plasmid for the XPO5 gene. |
XPO5 cloning plasmid |
CSB-CL864014HU2-10ug |
Cusabio |
10ug |
EUR 671 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2007
- Sequence: atggttctgaactttgataccaaggatcccctcatcctgtcctgcgtccttactaatgtctctgcactctttccatttgtcacctacagaccagagttcctgccccaggtcttctctaagctattttcatctgtcacttttgaaactgttgaagaaagtaaggcccccagaaccc
- Show more
|
Description: A cloning plasmid for the XPO5 gene. |
XPO5 Rabbit pAb |
A6790-100ul |
Abclonal |
100 ul |
EUR 308 |
XPO5 Rabbit pAb |
A6790-200ul |
Abclonal |
200 ul |
EUR 459 |
XPO5 Rabbit pAb |
A6790-20ul |
Abclonal |
20 ul |
EUR 183 |
XPO5 Rabbit pAb |
A6790-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-XPO5 antibody |
STJ28873 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the karyopherin family that is required for the transport of small RNAs and double-stranded RNA-binding proteins from the nucleus to the cytoplasm. The encoded protein translocates cargo through the nuclear pore complex in a RanGTP-dependent process. |
5-Hydroxytryptamine (5-HT) ELISA Kit |
DLR-5-HT-Ge-48T |
DL Develop |
48T |
EUR 469 |
- Should the 5-Hydroxytryptamine (5-HT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxytryptamine (5-HT) in samples from serum, plasma or other biological fluids. |
5-Hydroxytryptamine (5-HT) ELISA Kit |
DLR-5-HT-Ge-96T |
DL Develop |
96T |
EUR 608 |
- Should the 5-Hydroxytryptamine (5-HT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxytryptamine (5-HT) in samples from serum, plasma or other biological fluids. |
anti-Exportin T |
YF-PA17549 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Anti-Exportin T |
Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit |
DLR-CA19-5-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 19-5 (CA19-5) in samples from serum, plasma or other biological fluids. |
Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit |
DLR-CA19-5-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 19-5 (CA19-5) in samples from serum, plasma or other biological fluids. |
Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit |
RDR-CA19-5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit |
RDR-CA19-5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit |
RD-CA19-5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit |
RD-CA19-5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
XPO5 ORF Vector (Human) (pORF) |
ORF011647 |
ABM |
1.0 ug DNA |
EUR 95 |
XPO5 ORF Vector (Human) (pORF) |
ORF011648 |
ABM |
1.0 ug DNA |
EUR 95 |
Human Exportin 1 (XPo1) Protein |
20-abx168854 |
Abbexa |
-
EUR 620.00
-
EUR 272.00
-
EUR 1845.00
-
EUR 732.00
-
EUR 453.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Exportin 6 (XPO6) Protein |
20-abx650936 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit |
DLR-5-HIAA-Ge-48T |
DL Develop |
48T |
EUR 575 |
- Should the 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxyindoleacetic Acid (5-HIAA) in samples from serum, plasma, tissue homogenates or other biological fluids. |
5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit |
DLR-5-HIAA-Ge-96T |
DL Develop |
96T |
EUR 753 |
- Should the 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxyindoleacetic Acid (5-HIAA) in samples from serum, plasma, tissue homogenates or other biological fluids. |
General 5-Hydroxytryptamine (5-HT) ELISA Kit |
RD-5-HT-Ge-48Tests |
Reddot Biotech |
48 Tests |
EUR 467 |
General 5-Hydroxytryptamine (5-HT) ELISA Kit |
RD-5-HT-Ge-96Tests |
Reddot Biotech |
96 Tests |
EUR 646 |
General 5-Hydroxytryptamine (5-HT) ELISA Kit |
RDR-5-HT-Ge-48Tests |
Reddot Biotech |
48 Tests |
EUR 488 |
General 5-Hydroxytryptamine (5-HT) ELISA Kit |
RDR-5-HT-Ge-96Tests |
Reddot Biotech |
96 Tests |
EUR 676 |
OxiSelect Nitrotyrosine ELISA Kit (5 plates) |
STA-305-5 |
Cell Biolabs |
5 x 96 assays |
EUR 3240 |
Description: Nitric oxide influences a variety of biological processes including cell proliferation, apoptosis, neurotoxicity and extracellular matrix remodeling. Nitric oxide reacts with superoxide to form peroxynitrite, which in turn nitrates tyrosine residues in proteins. Nitrotyrosine therefore serves as a marker for peroxynitrite action in a variety of disease states and in conditions of cellular damage and oxidative stress. Our OxiSelect Nitrotyrosine ELISA Kit provides a sensitive method to measure the formation of 3-nitrotyrosine in proteins. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse XPO5 shRNA Plasmid |
20-abx977735 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
General 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit |
RDR-5-HIAA-Ge-48Tests |
Reddot Biotech |
48 Tests |
EUR 613 |
General 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit |
RDR-5-HIAA-Ge-96Tests |
Reddot Biotech |
96 Tests |
EUR 854 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
XPO5 sgRNA CRISPR Lentivector set (Human) |
K2650801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Anti-Exportin-4 Antibody |
A08052 |
BosterBio |
100 ug |
EUR 397 |
Description: Rabbit Polyclonal Exportin-4 Antibody. Validated in WB and tested in Human. |
Exportin-2 (XPO2) Antibody |
20-abx009395 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Exportin 1 (XPO1) Antibody |
20-abx214080 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exportin-4 (XPO4) Antibody |
20-abx219381 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exportin-1 (XPO1) Antibody |
20-abx112419 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exportin 6 (XPO6) Antibody |
20-abx112420 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exportin 7 (XPO7) Antibody |
20-abx112421 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exportin-6 (XPO6) Antibody |
20-abx126798 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Exportin-T (XPOT) Antibody |
20-abx126799 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Exportin-1 (XPO1) Antibody |
abx036759-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Exportin-6 (XPO6) Antibody |
abx037309-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Exportin 1 (XPO1) Antibody |
20-abx131010 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Exportin 1 (XPO1) Antibody |
20-abx172311 |
Abbexa |
|
|
|
Exportin 1 (XPO1) Antibody |
20-abx270287 |
Abbexa |
-
EUR 495.00
-
EUR 578.00
-
EUR 286.00
-
EUR 885.00
-
EUR 370.00
|
-
100 tests
-
200 tests
-
25 tests
-
500 tests
-
50 tests
|
- Shipped within 5-7 working days.
|
Exportin-6 (XPO6) Antibody |
abx239550-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Exportin-7 (XPO7) Antibody |
abx239551-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Exportin-6 (XPO6) Antibody |
20-abx321354 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exportin 1 (XPO1) Antibody |
20-abx327218 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exportin-1 (XPO1) Antibody |
20-abx318251 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Exportin-1 (XPO1) Antibody |
20-abx000678 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Recombinant Exportin 1 (XPo1) |
4-RPC258Hu01 |
Cloud-Clone |
-
EUR 436.90
-
EUR 220.00
-
EUR 1363.36
-
EUR 521.12
-
EUR 942.24
-
EUR 355.00
-
EUR 3258.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O14980
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 21.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Exportin 1 expressed in: E.coli |
Recombinant Exportin 6 (XPO6) |
4-RPF159Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q96QU8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.3kDa
- Isoelectric Point: 5.3
|
Description: Recombinant Human Exportin 6 expressed in: E.coli |
Recombinant Exportin 4 (XPO4) |
4-RPF161Hu01 |
Cloud-Clone |
-
EUR 592.80
-
EUR 262.00
-
EUR 1948.00
-
EUR 716.00
-
EUR 1332.00
-
EUR 460.00
-
EUR 4720.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.3kDa
- Isoelectric Point: 4.7
|
Description: Recombinant Human Exportin 4 expressed in: E.coli |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
OxiSelect Protein Carbonyl ELISA Kit (5 plates) |
STA-310-5 |
Cell Biolabs |
5 x 96 assays |
EUR 3240 |
Description: The most common products of protein oxidation in biological samples are the carbonyl derivatives of proline, lysine, arginine and threonine residues. Such derivatives are chemically stable and serve as markers for oxidative stress in most types of reactive oxygen species. Our OxiSelect Protein Carbonyl ELISA Kit provides a rapid, efficient method for the detection of protein carbonyl residues. The ELISA format is perfect for higher throughput and high sensitivity; we have eliminated concentration and precipitation steps allowing greater sample retention. |
2',3',5'-triacetyl-5-Azacytidine |
B2822-5 |
Biovision |
|
EUR 153 |
2',3',5'-triacetyl-5-Azacytidine |
C4119-5 |
ApexBio |
5 mg |
EUR 118 |
Description: 2',3',5'-triacetyl-5-Azacytidine (TAC) is the lead prodrug form of 5-azacytidine which may be rapidly absorbed after oral administration [1]. 5-Azacytidine is an inhibitor of DNA methyltransferase [2]. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
5-Iodotubercidin |
A3125-5 |
ApexBio |
5 mg |
EUR 168 |
Description: 5-Iodotubercidin (Itu) is a purine derivative and hence an inhibitor of adenosine kinase with an IC50 value of 26 nM [1]. Adenosine kinase is important in regulating the intracellular and extracellular concentrations of adenosine and hence diverse physiological actions of adenosine [2]. |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Xpo5 ORF Vector (Mouse) (pORF) |
ORF061967 |
ABM |
1.0 ug DNA |
EUR 506 |
Xpo5 ORF Vector (Rat) (pORF) |
ORF079216 |
ABM |
1.0 ug DNA |
EUR 506 |
h XPO5 inducible lentiviral particles |
LVP070 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, XPO5, is fully sequence verified and matched to NCBI accession ID: NM_020750.2 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
XPO5 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2650802 |
ABM |
1.0 ug DNA |
EUR 154 |
XPO5 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2650803 |
ABM |
1.0 ug DNA |
EUR 154 |
XPO5 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2650804 |
ABM |
1.0 ug DNA |
EUR 154 |
XPO5 Protein Vector (Human) (pPB-C-His) |
PV046585 |
ABM |
500 ng |
EUR 329 |
XPO5 Protein Vector (Human) (pPB-N-His) |
PV046586 |
ABM |
500 ng |
EUR 329 |
XPO5 Protein Vector (Human) (pPM-C-HA) |
PV046587 |
ABM |
500 ng |
EUR 329 |
XPO5 Protein Vector (Human) (pPM-C-His) |
PV046588 |
ABM |
500 ng |
EUR 329 |
XPO5 Protein Vector (Human) (pPB-C-His) |
PV046589 |
ABM |
500 ng |
EUR 329 |
XPO5 Protein Vector (Human) (pPB-N-His) |
PV046590 |
ABM |
500 ng |
EUR 329 |
XPO5 Protein Vector (Human) (pPM-C-HA) |
PV046591 |
ABM |
500 ng |
EUR 329 |
XPO5 Protein Vector (Human) (pPM-C-His) |
PV046592 |
ABM |
500 ng |
EUR 329 |
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Exportin-1 (XPO1) Antibody (HRP) |
20-abx316080 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Exportin-1 (XPO1) Antibody (FITC) |
20-abx316081 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Exportin-1 (XPO1) Antibody (Biotin) |
20-abx316082 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Exportin 1 (XPO1) Polyclonal Antibody (Human, Pig) |
4-PAC258Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: XPo1 (Thr917~Asp1071)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Pig Exportin 1 (XPO1) |
Human XPO5(Exportin 5) ELISA Kit