
Human brain gene expression atlas project

Human XPO5(Exportin 5) ELISA Kit

Human XPO5(Exportin 5) ELISA Kit

Human Exportin 5 (XPO5) ELISA Kit

RD-XPO5-Hu-96Tests 96 Tests
EUR 723

Human Exportin- 5, XPO5 ELISA KIT

ELI-40546h 96 Tests
EUR 824

Human Exportin 5 (XPO5) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Exportin 5(XPO5)ELISA Kit

QY-E01490 96T
EUR 361

Human Exportin 5 (XPO5) ELISA Kit

SEF160Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids.

Human Exportin 5 (XPO5) ELISA Kit

SEF160Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids.

Human Exportin 5 (XPO5) ELISA Kit

SEF160Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids.

Human Exportin 5 (XPO5) ELISA Kit

SEF160Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids.

Human Exportin 5 (XPO5) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Exportin 5 elisa. Alternative names of the recognized antigen: RANBP21
  • Exp5
  • Ran-binding protein 21
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exportin 5 (XPO5) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Exportin 5 (XPO5) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Exportin 5 (XPO5) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin 5 (XPO5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin 5 (XPO5) Antibody

abx028558-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Exportin 5 (XPO5) Antibody

abx028558-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Exportin 5 (XPO5) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Exportin 5 (XPO5)

  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9HAV4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Exportin 5 expressed in: E.coli

Mouse Exportin- 5, Xpo5 ELISA KIT

ELI-17533m 96 Tests
EUR 865

Human Exportin 5 (XPO5) Protein

  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Exportin 5 (XPO5) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human XPO5 (Exportin 5)

ELK3681 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exportin 5 (XPO5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exportin 5 (XPO5
  • Show more
Description: A sandwich ELISA kit for detection of Exportin 5 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Exportin-5 (XPO5)

KTE60011-48T 48T
EUR 332
  • Exportin-5 belongs to a large family of karyopherins that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments. The deduced 1,205-amino acid protein has a calculated molecular mass of about 136 kD. XPO5 a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-5 (XPO5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Exportin-5 (XPO5)

KTE60011-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Exportin-5 belongs to a large family of karyopherins that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments. The deduced 1,205-amino acid protein has a calculated molecular mass of about 136 kD. XPO5 a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-5 (XPO5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Exportin-5 (XPO5)

KTE60011-96T 96T
EUR 539
  • Exportin-5 belongs to a large family of karyopherins that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments. The deduced 1,205-amino acid protein has a calculated molecular mass of about 136 kD. XPO5 a
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-5 (XPO5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Anti-Exportin-5/XPO5 Antibody

A02900 100ug/vial
EUR 294

Exportin 5 (XPO5) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: XPO5 (Ala2~Gln180)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5)

Exportin 5 (XPO5) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: XPO5 (Ala2~Gln180)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with APC.

Exportin 5 (XPO5) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: XPO5 (Ala2~Gln180)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with Biotin.

Exportin 5 (XPO5) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: XPO5 (Ala2~Gln180)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with Cy3.

Exportin 5 (XPO5) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: XPO5 (Ala2~Gln180)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with FITC.

Exportin 5 (XPO5) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: XPO5 (Ala2~Gln180)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with HRP.

Exportin 5 (XPO5) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: XPO5 (Ala2~Gln180)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with PE.

Exportin 5 (XPO5) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: XPO5 (Ala2~Gln180)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with APC-Cy7.

Exportin-5 Antibody

49981-100ul 100ul
EUR 333

Exportin-5 Antibody

49981-50ul 50ul
EUR 239


YF-PA20209 50 ug
EUR 363
Description: Mouse polyclonal to Exportin-5


YF-PA20210 100 ug
EUR 403
Description: Rabbit polyclonal to Exportin-5


YF-PA26482 50 ul
EUR 334
Description: Mouse polyclonal to Exportin-5

Exportin-5 Conjugated Antibody

C49981 100ul
EUR 397

Exportin 5 Rabbit mAb

A3813-100ul 100 ul
EUR 410

Exportin 5 Rabbit mAb

A3813-200ul 200 ul
EUR 571

Exportin 5 Rabbit mAb

A3813-20ul 20 ul
EUR 221

Exportin 5 Rabbit mAb

A3813-50ul 50 ul
EUR 287

XPO5 ELISA Kit (Human) (OKCD00958)

OKCD00958 96 Wells
EUR 831
Description: Description of target: Mediates the nuclear export of proteins bearing a double-stranded RNA binding domain (dsRBD) and double-stranded RNAs (cargos). XPO5 in the nucleus binds cooperatively to the RNA and to the GTPase Ran in its active GTP-bound form. Proteins containing dsRBDs can associate with this trimeric complex through the RNA. Docking of this complex to the nuclear pore complex (NPC) is mediated through binding to nucleoporins. Upon transit of a nuclear export complex into the cytoplasm, hydrolysis of Ran-GTP to Ran-GDP (induced by RANBP1 and RANGAP1, respectively) cause disassembly of the complex and release of the cargo from the export receptor. XPO5 then returns to the nuclear compartment by diffusion through the nuclear pore complex, to mediate another round of transport. The directionality of nuclear export is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus. Overexpression may in some circumstances enhance RNA-mediated gene silencing (RNAi). Mediates nuclear export of isoform 5 of ADAR/ADAR1 in a RanGTP-dependent manner. Mediates the nuclear export of micro-RNA precursors, which form short hairpins. Also mediates the nuclear export of synthetic short hairpin RNAs used for RNA interference, and adenovirus VA1 dsRNA. In some circumstances can also mediate the nuclear export of deacylated and aminoacylated tRNAs. Specifically recognizes dsRNAs that lack a 5'-overhang in a sequence-independent manner, have only a short 3'-overhang, and that have a double-stranded length of at least 15 base-pairs. Binding is dependent on Ran-GTP. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

anti-Exportin-5 (2C5-1B3)

LF-MA10381 50 ug
EUR 363
Description: Mouse monoclonal to Exportin-5

Anti-Exportin-5 (2C5-1B3)

YF-MA19064 200 ul
EUR 363
Description: Mouse monoclonal to Exportin-5

Human Exportin- 4, XPO4 ELISA KIT

ELI-17962h 96 Tests
EUR 824

Human Exportin- 6, XPO6 ELISA KIT

ELI-17963h 96 Tests
EUR 824

Human Exportin- 7, XPO7 ELISA KIT

ELI-17964h 96 Tests
EUR 824

Human Exportin- T, XPOT ELISA KIT

ELI-22388h 96 Tests
EUR 824

Human Exportin- 2, CSE1L ELISA KIT

ELI-14974h 96 Tests
EUR 824

Human Exportin- 1, XPO1 ELISA KIT

ELI-17407h 96 Tests
EUR 824

Human Exportin 1 (XPO1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Exportin-6 (XPO6) ELISA Kit

abx384332-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Exportin-7 (XPO7) ELISA Kit

abx384333-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Exportin 1 (XPO1)ELISA Kit

201-12-2695 96 tests
EUR 440
  • This Exportin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Exportin 1 (XPO1) ELISA Kit

DLR-XPO1-Hu-48T 48T
EUR 517
  • Should the Human Exportin 1 (XPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exportin 1 (XPO1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit

DLR-XPO1-Hu-96T 96T
EUR 673
  • Should the Human Exportin 1 (XPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exportin 1 (XPO1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exportin-4(XPO4) ELISA kit

CSB-EL026222HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Exportin-4 (XPO4) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Exportin-4(XPO4) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Exportin-4(XPO4) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Exportin 1 (XPO1) ELISA Kit

SEC258Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit

SEC258Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit

SEC258Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit

SEC258Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Exportin 1 elisa. Alternative names of the recognized antigen: Exp1
  • CRM1 Homolog, Yeast
  • Chromosome region maintenance 1 protein homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exportin 1 (XPO1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Exportin 1 (XPO1) ELISA Kit

RDR-XPO1-Hu-48Tests 48 Tests
EUR 544

Human Exportin 1 (XPO1) ELISA Kit

RDR-XPO1-Hu-96Tests 96 Tests
EUR 756

Human Exportin 1 ELISA Kit (XPO1)

RK02534 96 Tests
EUR 521

Human Exportin 1 (XPO1) ELISA Kit

RD-XPO1-Hu-48Tests 48 Tests
EUR 521

Human Exportin 1 (XPO1) ELISA Kit

RD-XPO1-Hu-96Tests 96 Tests
EUR 723

Human Exportin 7(XPO7)ELISA Kit

QY-E01488 96T
EUR 361

Human Exportin 6(XPO6)ELISA Kit

QY-E01489 96T
EUR 361

Human Exportin 4(XPO4)ELISA Kit

QY-E01491 96T
EUR 361

Human Exportin 3(XPO3)ELISA Kit

QY-E01492 96T
EUR 361

Human Exportin 1(XPO1)ELISA Kit

QY-E01493 96T
EUR 361

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

ELISA kit for Human XPO1 (Exportin 1)

ELK4663 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exportin 1 (XPO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exportin 1 (XPO1
  • Show more
Description: A sandwich ELISA kit for detection of Exportin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Exportin-1 (XPO1)

KTE60012-48T 48T
EUR 332
  • Exportin-1 mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localiza
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-1 (XPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Exportin-1 (XPO1)

KTE60012-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Exportin-1 mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localiza
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-1 (XPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Exportin-1 (XPO1)

KTE60012-96T 96T
EUR 539
  • Exportin-1 mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localiza
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-1 (XPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

XPO5 antibody

70R-8741 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal XPO5 antibody

XPO5 antibody

70R-8742 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal XPO5 antibody

XPO5 antibody

70R-8743 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal XPO5 antibody

XPO5 antibody

39182-100ul 100ul
EUR 252

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

5-Formylcytosine (5-fC) ELISA Kit

MET-5102-5 5 x 96 assays
EUR 2283

5-Carboxylcytosine (5-caC) ELISA Kit

MET-5103-5 5 x 96 assays
EUR 2283

Mouse Exportin- 2, Cse1l ELISA KIT

ELI-22386m 96 Tests
EUR 865

Mouse Exportin- 7, Xpo7 ELISA KIT

ELI-22387m 96 Tests
EUR 865

Chicken Exportin- 7, XPO7 ELISA KIT

ELI-14975c 96 Tests
EUR 928

Mouse Exportin- T, Xpot ELISA KIT

ELI-14976m 96 Tests
EUR 865

Bovine Exportin- 2, CSE1L ELISA KIT

ELI-17532b 96 Tests
EUR 928

Chicken Exportin- 4, XPO4 ELISA KIT

ELI-28774c 96 Tests
EUR 928

Mouse Exportin- 1, Xpo1 ELISA KIT

ELI-51430m 96 Tests
EUR 865

Mouse Exportin- 4, Xpo4 ELISA KIT

ELI-51431m 96 Tests
EUR 865

Mouse Exportin- 6, Xpo6 ELISA KIT

ELI-51533m 96 Tests
EUR 865

Mouse Exportin-1 (Xpo1) ELISA Kit

abx389230-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Exportin-1 (Xpo1) ELISA Kit

abx391307-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human XPO5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Xpo1 ELISA Kit| Rat Exportin-1 ELISA Kit

EF018662 96 Tests
EUR 689

Xpo1 ELISA Kit| Mouse Exportin-1 ELISA Kit

EF014860 96 Tests
EUR 689

Human Exportin-2 (CSE1L)

  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 39.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Exportin-2(CSE1L),partial expressed in in vitro E.coli expression system

Human Exportin 1 (XPO1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

XPO5 Conjugated Antibody

C39182 100ul
EUR 397

XPO5 Rabbit pAb

A6790-100ul 100 ul
EUR 308

XPO5 Rabbit pAb

A6790-200ul 200 ul
EUR 459

XPO5 Rabbit pAb

A6790-20ul 20 ul
EUR 183

XPO5 Rabbit pAb

A6790-50ul 50 ul
EUR 223

XPO5 Blocking Peptide

33R-5489 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of XPO5 antibody, catalog no. 70R-8742

XPO5 Blocking Peptide

33R-5948 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of XPO5 antibody, catalog no. 70R-8743

XPO5 Blocking Peptide

33R-10360 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Xpo5 antibody, catalog no. 70R-8741

XPO5 cloning plasmid

CSB-CL864014HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atgaggctttctcagaaatggcaagttatcaaccaaaggagcctgctgtgtggagaagatgaggctgcagatgaaaacccagagtctcaagagatgctggaggagcaactggtgaggatgttaacccgagaagtcatggacctaatcacggtttgctgtgtttcaaagaagggtgc
  • Show more
Description: A cloning plasmid for the XPO5 gene.

XPO5 cloning plasmid

CSB-CL864014HU2-10ug 10ug
EUR 671
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2007
  • Sequence: atggttctgaactttgataccaaggatcccctcatcctgtcctgcgtccttactaatgtctctgcactctttccatttgtcacctacagaccagagttcctgccccaggtcttctctaagctattttcatctgtcacttttgaaactgttgaagaaagtaaggcccccagaaccc
  • Show more
Description: A cloning plasmid for the XPO5 gene.


PVT12430 2 ug
EUR 391

Anti-XPO5 antibody

STJ28873 100 µl
EUR 277
Description: This gene encodes a member of the karyopherin family that is required for the transport of small RNAs and double-stranded RNA-binding proteins from the nucleus to the cytoplasm. The encoded protein translocates cargo through the nuclear pore complex in a RanGTP-dependent process.

5-Hydroxytryptamine (5-HT) ELISA Kit

DLR-5-HT-Ge-48T 48T
EUR 469
  • Should the 5-Hydroxytryptamine (5-HT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxytryptamine (5-HT) in samples from serum, plasma or other biological fluids.

5-Hydroxytryptamine (5-HT) ELISA Kit

DLR-5-HT-Ge-96T 96T
EUR 608
  • Should the 5-Hydroxytryptamine (5-HT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxytryptamine (5-HT) in samples from serum, plasma or other biological fluids.

anti-Exportin T

YF-PA17549 50 ul
EUR 363
Description: Mouse polyclonal to Anti-Exportin T

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit

DLR-CA19-5-Hu-48T 48T
EUR 554
  • Should the Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 19-5 (CA19-5) in samples from serum, plasma or other biological fluids.

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit

DLR-CA19-5-Hu-96T 96T
EUR 725
  • Should the Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 19-5 (CA19-5) in samples from serum, plasma or other biological fluids.

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit

RD-CA19-5-Hu-48Tests 48 Tests
EUR 563

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit

RD-CA19-5-Hu-96Tests 96 Tests
EUR 783

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit

RDR-CA19-5-Hu-48Tests 48 Tests
EUR 589

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit

RDR-CA19-5-Hu-96Tests 96 Tests
EUR 820

XPO5 ORF Vector (Human) (pORF)

ORF011647 1.0 ug DNA
EUR 95

XPO5 ORF Vector (Human) (pORF)

ORF011648 1.0 ug DNA
EUR 95

Human Exportin 6 (XPO6) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Exportin 1 (XPo1) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1845.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit

DLR-5-HIAA-Ge-48T 48T
EUR 575
  • Should the 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxyindoleacetic Acid (5-HIAA) in samples from serum, plasma, tissue homogenates or other biological fluids.

5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit

DLR-5-HIAA-Ge-96T 96T
EUR 753
  • Should the 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxyindoleacetic Acid (5-HIAA) in samples from serum, plasma, tissue homogenates or other biological fluids.

General 5-Hydroxytryptamine (5-HT) ELISA Kit

RD-5-HT-Ge-48Tests 48 Tests
EUR 467

General 5-Hydroxytryptamine (5-HT) ELISA Kit

RD-5-HT-Ge-96Tests 96 Tests
EUR 646

General 5-Hydroxytryptamine (5-HT) ELISA Kit

RDR-5-HT-Ge-48Tests 48 Tests
EUR 488

General 5-Hydroxytryptamine (5-HT) ELISA Kit

RDR-5-HT-Ge-96Tests 96 Tests
EUR 676

OxiSelect Nitrotyrosine ELISA Kit (5 plates)

STA-305-5 5 x 96 assays
EUR 3240
Description: Nitric oxide influences a variety of biological processes including cell proliferation, apoptosis, neurotoxicity and extracellular matrix remodeling. Nitric oxide reacts with superoxide to form peroxynitrite, which in turn nitrates tyrosine residues in proteins. Nitrotyrosine therefore serves as a marker for peroxynitrite action in a variety of disease states and in conditions of cellular damage and oxidative stress. Our OxiSelect Nitrotyrosine ELISA Kit provides a sensitive method to measure the formation of 3-nitrotyrosine in proteins.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse XPO5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

General 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit

RDR-5-HIAA-Ge-48Tests 48 Tests
EUR 613

General 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit

RDR-5-HIAA-Ge-96Tests 96 Tests
EUR 854

XPO5 sgRNA CRISPR Lentivector set (Human)

K2650801 3 x 1.0 ug
EUR 339

Exportin-6 (XPO6) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin-T (XPOT) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin 6 (XPO6) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin 7 (XPO7) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Exportin-1 (XPO1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody

abx036759-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody

abx037309-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Exportin-2 (XPO2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Exportin-6 (XPO6) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exportin-4 (XPO4) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody

  • EUR 495.00
  • EUR 578.00
  • EUR 286.00
  • EUR 885.00
  • EUR 370.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-7 working days.

Exportin-6 (XPO6) Antibody

abx239550-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Exportin-7 (XPO7) Antibody

abx239551-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Exportin-4 Antibody

A08052 100 ug
EUR 397
Description: Rabbit Polyclonal Exportin-4 Antibody. Validated in WB and tested in Human.

Recombinant Exportin 6 (XPO6)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q96QU8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.3kDa
  • Isoelectric Point: 5.3
Description: Recombinant Human Exportin 6 expressed in: E.coli

Recombinant Exportin 4 (XPO4)

  • EUR 592.80
  • EUR 262.00
  • EUR 1948.00
  • EUR 716.00
  • EUR 1332.00
  • EUR 460.00
  • EUR 4720.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.3kDa
  • Isoelectric Point: 4.7
Description: Recombinant Human Exportin 4 expressed in: E.coli

Recombinant Exportin 1 (XPo1)

  • EUR 436.90
  • EUR 220.00
  • EUR 1363.36
  • EUR 521.12
  • EUR 942.24
  • EUR 355.00
  • EUR 3258.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O14980
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Exportin 1 expressed in: E.coli

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

IL-8 (-5 to +5)

5-01377 4 x 5mg Ask for price

OxiSelect Protein Carbonyl ELISA Kit (5 plates)

STA-310-5 5 x 96 assays
EUR 3240
Description: The most common products of protein oxidation in biological samples are the carbonyl derivatives of proline, lysine, arginine and threonine residues. Such derivatives are chemically stable and serve as markers for oxidative stress in most types of reactive oxygen species. Our OxiSelect Protein Carbonyl ELISA Kit provides a rapid, efficient method for the detection of protein carbonyl residues. The ELISA format is perfect for higher throughput and high sensitivity; we have eliminated concentration and precipitation steps allowing greater sample retention.


C4119-5 5 mg
EUR 118
Description: 2',3',5'-triacetyl-5-Azacytidine (TAC) is the lead prodrug form of 5-azacytidine which may be rapidly absorbed after oral administration [1]. 5-Azacytidine is an inhibitor of DNA methyltransferase [2].


EUR 153

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9


EUR 142


B8212-5 5 mg
EUR 195


A3125-5 5 mg
EUR 168
Description: 5-Iodotubercidin (Itu) is a purine derivative and hence an inhibitor of adenosine kinase with an IC50 value of 26 nM [1]. Adenosine kinase is important in regulating the intracellular and extracellular concentrations of adenosine and hence diverse physiological actions of adenosine [2].

Histatin 5

5-01307 4 x 1mg Ask for price


EUR 126


EUR 457


EUR 153

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

h XPO5 inducible lentiviral particles

LVP070 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, XPO5, is fully sequence verified and matched to NCBI accession ID: NM_020750.2

Xpo5 ORF Vector (Rat) (pORF)

ORF079216 1.0 ug DNA
EUR 506

Xpo5 ORF Vector (Mouse) (pORF)

ORF061967 1.0 ug DNA
EUR 506

XPO5 sgRNA CRISPR Lentivector (Human) (Target 1)

K2650802 1.0 ug DNA
EUR 154

XPO5 sgRNA CRISPR Lentivector (Human) (Target 2)

K2650803 1.0 ug DNA
EUR 154

XPO5 sgRNA CRISPR Lentivector (Human) (Target 3)

K2650804 1.0 ug DNA
EUR 154

XPO5 Protein Vector (Human) (pPB-C-His)

PV046585 500 ng
EUR 329

XPO5 Protein Vector (Human) (pPB-N-His)

PV046586 500 ng
EUR 329

XPO5 Protein Vector (Human) (pPM-C-HA)

PV046587 500 ng
EUR 329

XPO5 Protein Vector (Human) (pPM-C-His)

PV046588 500 ng
EUR 329

XPO5 Protein Vector (Human) (pPB-C-His)

PV046589 500 ng
EUR 329

XPO5 Protein Vector (Human) (pPB-N-His)

PV046590 500 ng
EUR 329

XPO5 Protein Vector (Human) (pPM-C-HA)

PV046591 500 ng
EUR 329

XPO5 Protein Vector (Human) (pPM-C-His)

PV046592 500 ng
EUR 329

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Exportin-1 (XPO1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-RANBP16 / Exportin 7 antibody

STJ70494 100 µg
EUR 359

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Exportin 1 (XPO1) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: XPo1 (Thr917~Asp1071)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Exportin 1 (XPO1)

Human XPO5(Exportin 5) ELISA Kit