Human XPO5(Exportin 5) ELISA Kit

Human XPO5(Exportin 5) ELISA Kit

Human Exportin 5 (XPO5) ELISA Kit
RD-XPO5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Exportin- 5, XPO5 ELISA KIT
ELI-40546h	Lifescience Market	96 Tests	EUR 824

Human Exportin 5 (XPO5) ELISA Kit
20-abx151460	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Exportin 5(XPO5)ELISA Kit
QY-E01490	Qayee Biotechnology	96T	EUR 361

Human Exportin 5 (XPO5) ELISA Kit
SEF160Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids.

Human Exportin 5 (XPO5) ELISA Kit
SEF160Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids.

Human Exportin 5 (XPO5) ELISA Kit
SEF160Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids.

Human Exportin 5 (XPO5) ELISA Kit
SEF160Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 5 (XPO5) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 5 (XPO5) in Tissue homogenates and other biological fluids.

Human Exportin 5 (XPO5) ELISA Kit
4-SEF160Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Exportin 5 elisa. Alternative names of the recognized antigen: RANBP21 Exp5 Ran-binding protein 21
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exportin 5 (XPO5) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Exportin 5 (XPO5) Antibody
20-abx131534	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Exportin 5 (XPO5) Antibody
20-abx141913	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Exportin 5 (XPO5) Antibody
20-abx005208	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Exportin 5 (XPO5) Antibody
abx028558-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Exportin 5 (XPO5) Antibody
abx028558-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Exportin 5 (XPO5) Antibody
20-abx172312	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Exportin 5 (XPO5)
4-RPF160Hu01	Cloud-Clone	EUR 422.56 EUR 216.00 EUR 1309.60 EUR 503.20 EUR 906.40 EUR 346.00 EUR 3124.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9HAV4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Exportin 5 expressed in: E.coli

Mouse Exportin- 5, Xpo5 ELISA KIT
ELI-17533m	Lifescience Market	96 Tests	EUR 865

Human Exportin 5 (XPO5) Protein
20-abx650642	Abbexa	EUR 592.00 EUR 258.00 EUR 1776.00 EUR 704.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Exportin 5 (XPO5) CLIA Kit
20-abx494803	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human XPO5 (Exportin 5)
ELK3681	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exportin 5 (XPO5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exportin 5 (XPO5 Show more
Description: A sandwich ELISA kit for detection of Exportin 5 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Exportin-5 (XPO5)
KTE60011-48T	Abbkine	48T	EUR 332
Exportin-5 belongs to a large family of karyopherins that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments. The deduced 1,205-amino acid protein has a calculated molecular mass of about 136 kD. XPO5 a Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-5 (XPO5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Exportin-5 (XPO5)
KTE60011-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Exportin-5 belongs to a large family of karyopherins that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments. The deduced 1,205-amino acid protein has a calculated molecular mass of about 136 kD. XPO5 a Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-5 (XPO5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Exportin-5 (XPO5)
KTE60011-96T	Abbkine	96T	EUR 539
Exportin-5 belongs to a large family of karyopherins that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments. The deduced 1,205-amino acid protein has a calculated molecular mass of about 136 kD. XPO5 a Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-5 (XPO5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Anti-Exportin-5/XPO5 Antibody
A02900	BosterBio	100ug/vial	EUR 294

Exportin 5 (XPO5) Polyclonal Antibody (Human)
4-PAF160Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: XPO5 (Ala2~Gln180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5)

Exportin 5 (XPO5) Polyclonal Antibody (Human), APC
4-PAF160Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: XPO5 (Ala2~Gln180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with APC.

Exportin 5 (XPO5) Polyclonal Antibody (Human), Biotinylated
4-PAF160Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: XPO5 (Ala2~Gln180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with Biotin.

Exportin 5 (XPO5) Polyclonal Antibody (Human), Cy3
4-PAF160Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: XPO5 (Ala2~Gln180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with Cy3.

Exportin 5 (XPO5) Polyclonal Antibody (Human), FITC
4-PAF160Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: XPO5 (Ala2~Gln180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with FITC.

Exportin 5 (XPO5) Polyclonal Antibody (Human), HRP
4-PAF160Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: XPO5 (Ala2~Gln180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with HRP.

Exportin 5 (XPO5) Polyclonal Antibody (Human), PE
4-PAF160Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: XPO5 (Ala2~Gln180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with PE.

Exportin 5 (XPO5) Polyclonal Antibody (Human), APC-Cy7
4-PAF160Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: XPO5 (Ala2~Gln180) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Exportin 5 (XPO5). This antibody is labeled with APC-Cy7.

Exportin-5 Antibody
49981-100ul	SAB	100ul	EUR 333

Exportin-5 Antibody
49981-50ul	SAB	50ul	EUR 239

anti-Exportin-5
YF-PA20209	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Exportin-5

anti-Exportin-5
YF-PA20210	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Exportin-5

anti-Exportin-5
YF-PA26482	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Exportin-5

Exportin-5 Conjugated Antibody
C49981	SAB	100ul	EUR 397

Exportin 5 Rabbit mAb
A3813-100ul	Abclonal	100 ul	EUR 410

Exportin 5 Rabbit mAb
A3813-200ul	Abclonal	200 ul	EUR 571

Exportin 5 Rabbit mAb
A3813-20ul	Abclonal	20 ul	EUR 221

Exportin 5 Rabbit mAb
A3813-50ul	Abclonal	50 ul	EUR 287

XPO5 ELISA Kit (Human) (OKCD00958)
OKCD00958	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Mediates the nuclear export of proteins bearing a double-stranded RNA binding domain (dsRBD) and double-stranded RNAs (cargos). XPO5 in the nucleus binds cooperatively to the RNA and to the GTPase Ran in its active GTP-bound form. Proteins containing dsRBDs can associate with this trimeric complex through the RNA. Docking of this complex to the nuclear pore complex (NPC) is mediated through binding to nucleoporins. Upon transit of a nuclear export complex into the cytoplasm, hydrolysis of Ran-GTP to Ran-GDP (induced by RANBP1 and RANGAP1, respectively) cause disassembly of the complex and release of the cargo from the export receptor. XPO5 then returns to the nuclear compartment by diffusion through the nuclear pore complex, to mediate another round of transport. The directionality of nuclear export is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus. Overexpression may in some circumstances enhance RNA-mediated gene silencing (RNAi). Mediates nuclear export of isoform 5 of ADAR/ADAR1 in a RanGTP-dependent manner. Mediates the nuclear export of micro-RNA precursors, which form short hairpins. Also mediates the nuclear export of synthetic short hairpin RNAs used for RNA interference, and adenovirus VA1 dsRNA. In some circumstances can also mediate the nuclear export of deacylated and aminoacylated tRNAs. Specifically recognizes dsRNAs that lack a 5'-overhang in a sequence-independent manner, have only a short 3'-overhang, and that have a double-stranded length of at least 15 base-pairs. Binding is dependent on Ran-GTP. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

anti-Exportin-5 (2C5-1B3)
LF-MA10381	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to Exportin-5

Anti-Exportin-5 (2C5-1B3)
YF-MA19064	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to Exportin-5

Human Exportin- 4, XPO4 ELISA KIT
ELI-17962h	Lifescience Market	96 Tests	EUR 824

Human Exportin- 6, XPO6 ELISA KIT
ELI-17963h	Lifescience Market	96 Tests	EUR 824

Human Exportin- 7, XPO7 ELISA KIT
ELI-17964h	Lifescience Market	96 Tests	EUR 824

Human Exportin- T, XPOT ELISA KIT
ELI-22388h	Lifescience Market	96 Tests	EUR 824

Human Exportin- 2, CSE1L ELISA KIT
ELI-14974h	Lifescience Market	96 Tests	EUR 824

Human Exportin- 1, XPO1 ELISA KIT
ELI-17407h	Lifescience Market	96 Tests	EUR 824

Human Exportin 1 (XPO1) ELISA Kit
20-abx151459	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Exportin-6 (XPO6) ELISA Kit
abx384332-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Exportin-7 (XPO7) ELISA Kit
abx384333-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Exportin 1 (XPO1)ELISA Kit
201-12-2695	SunredBio	96 tests	EUR 440
This Exportin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Exportin 1 (XPO1) ELISA Kit
DLR-XPO1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Exportin 1 (XPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exportin 1 (XPO1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit
DLR-XPO1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Exportin 1 (XPO1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Exportin 1 (XPO1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Exportin-4(XPO4) ELISA kit
CSB-EL026222HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Exportin-4 (XPO4) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Exportin-4(XPO4) ELISA kit
1-CSB-EL026222HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Exportin-4(XPO4) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Exportin 1 (XPO1) ELISA Kit
SEC258Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit
SEC258Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit
SEC258Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit
SEC258Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Exportin 1 (XPO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Exportin 1 (XPO1) in Tissue homogenates, cell lysates and other biological fluids.

Human Exportin 1 (XPO1) ELISA Kit
4-SEC258Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Exportin 1 elisa. Alternative names of the recognized antigen: Exp1 CRM1 Homolog, Yeast Chromosome region maintenance 1 protein homolog
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Exportin 1 (XPO1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Exportin 1 (XPO1) ELISA Kit
RDR-XPO1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Exportin 1 (XPO1) ELISA Kit
RDR-XPO1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Exportin 1 ELISA Kit (XPO1)
RK02534	Abclonal	96 Tests	EUR 521

Human Exportin 1 (XPO1) ELISA Kit
RD-XPO1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Exportin 1 (XPO1) ELISA Kit
RD-XPO1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Exportin 7(XPO7)ELISA Kit
QY-E01488	Qayee Biotechnology	96T	EUR 361

Human Exportin 6(XPO6)ELISA Kit
QY-E01489	Qayee Biotechnology	96T	EUR 361

Human Exportin 4(XPO4)ELISA Kit
QY-E01491	Qayee Biotechnology	96T	EUR 361

Human Exportin 3(XPO3)ELISA Kit
QY-E01492	Qayee Biotechnology	96T	EUR 361

Human Exportin 1(XPO1)ELISA Kit
QY-E01493	Qayee Biotechnology	96T	EUR 361

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

ELISA kit for Human XPO1 (Exportin 1)
ELK4663	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Exportin 1 (XPO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Exportin 1 (XPO1 Show more
Description: A sandwich ELISA kit for detection of Exportin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Exportin-1 (XPO1)
KTE60012-48T	Abbkine	48T	EUR 332
Exportin-1 mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localiza Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-1 (XPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Exportin-1 (XPO1)
KTE60012-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Exportin-1 mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localiza Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-1 (XPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Exportin-1 (XPO1)
KTE60012-96T	Abbkine	96T	EUR 539
Exportin-1 mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localiza Show more
Description: Quantitative sandwich ELISA for measuring Human Exportin-1 (XPO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

XPO5 siRNA
20-abx940015	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

XPO5 siRNA
20-abx940016	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

XPO5 antibody
70R-8741	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal XPO5 antibody

XPO5 antibody
70R-8742	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal XPO5 antibody

XPO5 antibody
70R-8743	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal XPO5 antibody

XPO5 antibody
39182-100ul	SAB	100ul	EUR 252

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

5-Formylcytosine (5-fC) ELISA Kit
MET-5102-5	Cell Biolabs	5 x 96 assays	EUR 2283

5-Carboxylcytosine (5-caC) ELISA Kit
MET-5103-5	Cell Biolabs	5 x 96 assays	EUR 2283

Mouse Exportin- 2, Cse1l ELISA KIT
ELI-22386m	Lifescience Market	96 Tests	EUR 865

Mouse Exportin- 7, Xpo7 ELISA KIT
ELI-22387m	Lifescience Market	96 Tests	EUR 865

Chicken Exportin- 7, XPO7 ELISA KIT
ELI-14975c	Lifescience Market	96 Tests	EUR 928

Mouse Exportin- T, Xpot ELISA KIT
ELI-14976m	Lifescience Market	96 Tests	EUR 865

Bovine Exportin- 2, CSE1L ELISA KIT
ELI-17532b	Lifescience Market	96 Tests	EUR 928

Chicken Exportin- 4, XPO4 ELISA KIT
ELI-28774c	Lifescience Market	96 Tests	EUR 928

Mouse Exportin- 1, Xpo1 ELISA KIT
ELI-51430m	Lifescience Market	96 Tests	EUR 865

Mouse Exportin- 4, Xpo4 ELISA KIT
ELI-51431m	Lifescience Market	96 Tests	EUR 865

Mouse Exportin- 6, Xpo6 ELISA KIT
ELI-51533m	Lifescience Market	96 Tests	EUR 865

Mouse Exportin-1 (Xpo1) ELISA Kit
abx389230-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Exportin-1 (Xpo1) ELISA Kit
abx391307-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human XPO5 shRNA Plasmid
20-abx961495	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Xpo1 ELISA Kit| Rat Exportin-1 ELISA Kit
EF018662	Lifescience Market	96 Tests	EUR 689

Xpo1 ELISA Kit| Mouse Exportin-1 ELISA Kit
EF014860	Lifescience Market	96 Tests	EUR 689

Human Exportin-2 (CSE1L)
1-CSB-CF006042HU	Cusabio	EUR 965.00 EUR 665.00 EUR 715.00	1MG 200ug 500ug
MW: 39.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Exportin-2(CSE1L),partial expressed in in vitro E.coli expression system

Human Exportin 1 (XPO1) CLIA Kit
20-abx493572	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

XPO5 Conjugated Antibody
C39182	SAB	100ul	EUR 397

XPO5 Rabbit pAb
A6790-100ul	Abclonal	100 ul	EUR 308

XPO5 Rabbit pAb
A6790-200ul	Abclonal	200 ul	EUR 459

XPO5 Rabbit pAb
A6790-20ul	Abclonal	20 ul	EUR 183

XPO5 Rabbit pAb
A6790-50ul	Abclonal	50 ul	EUR 223

XPO5 Blocking Peptide
33R-5489	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of XPO5 antibody, catalog no. 70R-8742

XPO5 Blocking Peptide
33R-5948	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of XPO5 antibody, catalog no. 70R-8743

XPO5 Blocking Peptide
33R-10360	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Xpo5 antibody, catalog no. 70R-8741

XPO5 cloning plasmid
CSB-CL864014HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 843 Sequence: atgaggctttctcagaaatggcaagttatcaaccaaaggagcctgctgtgtggagaagatgaggctgcagatgaaaacccagagtctcaagagatgctggaggagcaactggtgaggatgttaacccgagaagtcatggacctaatcacggtttgctgtgtttcaaagaagggtgc Show more
Description: A cloning plasmid for the XPO5 gene.

XPO5 cloning plasmid
CSB-CL864014HU2-10ug	Cusabio	10ug	EUR 671
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2007 Sequence: atggttctgaactttgataccaaggatcccctcatcctgtcctgcgtccttactaatgtctctgcactctttccatttgtcacctacagaccagagttcctgccccaggtcttctctaagctattttcatctgtcacttttgaaactgttgaagaaagtaaggcccccagaaccc Show more
Description: A cloning plasmid for the XPO5 gene.

pCMV-SPORT6-XPO5
PVT12430	Lifescience Market	2 ug	EUR 391

Anti-XPO5 antibody
STJ28873	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the karyopherin family that is required for the transport of small RNAs and double-stranded RNA-binding proteins from the nucleus to the cytoplasm. The encoded protein translocates cargo through the nuclear pore complex in a RanGTP-dependent process.

5-Hydroxytryptamine (5-HT) ELISA Kit
DLR-5-HT-Ge-48T	DL Develop	48T	EUR 469
Should the 5-Hydroxytryptamine (5-HT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxytryptamine (5-HT) in samples from serum, plasma or other biological fluids.

5-Hydroxytryptamine (5-HT) ELISA Kit
DLR-5-HT-Ge-96T	DL Develop	96T	EUR 608
Should the 5-Hydroxytryptamine (5-HT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxytryptamine (5-HT) in samples from serum, plasma or other biological fluids.

anti-Exportin T
YF-PA17549	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Anti-Exportin T

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit
DLR-CA19-5-Hu-48T	DL Develop	48T	EUR 554
Should the Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 19-5 (CA19-5) in samples from serum, plasma or other biological fluids.

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit
DLR-CA19-5-Hu-96T	DL Develop	96T	EUR 725
Should the Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 19-5 (CA19-5) in samples from serum, plasma or other biological fluids.

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit
RD-CA19-5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit
RD-CA19-5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit
RDR-CA19-5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Carbohydrate Antigen 19-5 (CA19-5) ELISA Kit
RDR-CA19-5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

XPO5 ORF Vector (Human) (pORF)
ORF011647	ABM	1.0 ug DNA	EUR 95

XPO5 ORF Vector (Human) (pORF)
ORF011648	ABM	1.0 ug DNA	EUR 95

Human Exportin 6 (XPO6) Protein
20-abx650936	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Exportin 1 (XPo1) Protein
20-abx168854	Abbexa	EUR 620.00 EUR 272.00 EUR 1845.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit
DLR-5-HIAA-Ge-48T	DL Develop	48T	EUR 575
Should the 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxyindoleacetic Acid (5-HIAA) in samples from serum, plasma, tissue homogenates or other biological fluids.

5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit
DLR-5-HIAA-Ge-96T	DL Develop	96T	EUR 753
Should the 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 5-Hydroxyindoleacetic Acid (5-HIAA) in samples from serum, plasma, tissue homogenates or other biological fluids.

General 5-Hydroxytryptamine (5-HT) ELISA Kit
RD-5-HT-Ge-48Tests	Reddot Biotech	48 Tests	EUR 467

General 5-Hydroxytryptamine (5-HT) ELISA Kit
RD-5-HT-Ge-96Tests	Reddot Biotech	96 Tests	EUR 646

General 5-Hydroxytryptamine (5-HT) ELISA Kit
RDR-5-HT-Ge-48Tests	Reddot Biotech	48 Tests	EUR 488

General 5-Hydroxytryptamine (5-HT) ELISA Kit
RDR-5-HT-Ge-96Tests	Reddot Biotech	96 Tests	EUR 676

OxiSelect Nitrotyrosine ELISA Kit (5 plates)
STA-305-5	Cell Biolabs	5 x 96 assays	EUR 3240
Description: Nitric oxide influences a variety of biological processes including cell proliferation, apoptosis, neurotoxicity and extracellular matrix remodeling. Nitric oxide reacts with superoxide to form peroxynitrite, which in turn nitrates tyrosine residues in proteins. Nitrotyrosine therefore serves as a marker for peroxynitrite action in a variety of disease states and in conditions of cellular damage and oxidative stress. Our OxiSelect Nitrotyrosine ELISA Kit provides a sensitive method to measure the formation of 3-nitrotyrosine in proteins.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse XPO5 shRNA Plasmid
20-abx977735	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

General 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit
RDR-5-HIAA-Ge-48Tests	Reddot Biotech	48 Tests	EUR 613

General 5-Hydroxyindoleacetic Acid (5-HIAA) ELISA Kit
RDR-5-HIAA-Ge-96Tests	Reddot Biotech	96 Tests	EUR 854

XPO5 sgRNA CRISPR Lentivector set (Human)
K2650801	ABM	3 x 1.0 ug	EUR 339

Exportin-6 (XPO6) Antibody
20-abx126798	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Exportin-T (XPOT) Antibody
20-abx126799	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody
20-abx112419	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Exportin 6 (XPO6) Antibody
20-abx112420	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Exportin 7 (XPO7) Antibody
20-abx112421	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody
20-abx131010	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Exportin-1 (XPO1) Antibody
20-abx000678	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody
abx036759-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody
abx037309-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Exportin-2 (XPO2) Antibody
20-abx009395	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody
20-abx172311	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Exportin-6 (XPO6) Antibody
20-abx321354	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody
20-abx327218	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody
20-abx214080	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Exportin-4 (XPO4) Antibody
20-abx219381	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody
20-abx318251	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Exportin 1 (XPO1) Antibody
20-abx270287	Abbexa	EUR 495.00 EUR 578.00 EUR 286.00 EUR 885.00 EUR 370.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-7 working days.

Exportin-6 (XPO6) Antibody
abx239550-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Exportin-7 (XPO7) Antibody
abx239551-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Anti-Exportin-4 Antibody
A08052	BosterBio	100 ug	EUR 397
Description: Rabbit Polyclonal Exportin-4 Antibody. Validated in WB and tested in Human.

Recombinant Exportin 6 (XPO6)
4-RPF159Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q96QU8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.3kDa Isoelectric Point: 5.3
Description: Recombinant Human Exportin 6 expressed in: E.coli

Recombinant Exportin 4 (XPO4)
4-RPF161Hu01	Cloud-Clone	EUR 592.80 EUR 262.00 EUR 1948.00 EUR 716.00 EUR 1332.00 EUR 460.00 EUR 4720.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.3kDa Isoelectric Point: 4.7
Description: Recombinant Human Exportin 4 expressed in: E.coli

Recombinant Exportin 1 (XPo1)
4-RPC258Hu01	Cloud-Clone	EUR 436.90 EUR 220.00 EUR 1363.36 EUR 521.12 EUR 942.24 EUR 355.00 EUR 3258.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O14980 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Exportin 1 expressed in: E.coli

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

IL-8 (-5 to +5)
5-01377	CHI Scientific	4 x 5mg	Ask for price

OxiSelect Protein Carbonyl ELISA Kit (5 plates)
STA-310-5	Cell Biolabs	5 x 96 assays	EUR 3240
Description: The most common products of protein oxidation in biological samples are the carbonyl derivatives of proline, lysine, arginine and threonine residues. Such derivatives are chemically stable and serve as markers for oxidative stress in most types of reactive oxygen species. Our OxiSelect Protein Carbonyl ELISA Kit provides a rapid, efficient method for the detection of protein carbonyl residues. The ELISA format is perfect for higher throughput and high sensitivity; we have eliminated concentration and precipitation steps allowing greater sample retention.

2',3',5'-triacetyl-5-Azacytidine
C4119-5	ApexBio	5 mg	EUR 118
Description: 2',3',5'-triacetyl-5-Azacytidine (TAC) is the lead prodrug form of 5-azacytidine which may be rapidly absorbed after oral administration [1]. 5-Azacytidine is an inhibitor of DNA methyltransferase [2].

2',3',5'-triacetyl-5-Azacytidine
B2822-5	Biovision		EUR 153

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

GNF-5
B1329-5	Biovision		EUR 142

5-ROX
B8212-5	ApexBio	5 mg	EUR 195

5-Iodotubercidin
A3125-5	ApexBio	5 mg	EUR 168
Description: 5-Iodotubercidin (Itu) is a purine derivative and hence an inhibitor of adenosine kinase with an IC50 value of 26 nM [1]. Adenosine kinase is important in regulating the intracellular and extracellular concentrations of adenosine and hence diverse physiological actions of adenosine [2].

Histatin 5
5-01307	CHI Scientific	4 x 1mg	Ask for price

Necrostatin-5
1865-5	Biovision		EUR 126

Aftin-5
2575-5	Biovision		EUR 457

CHD-5
2693-5	Biovision		EUR 153

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

h XPO5 inducible lentiviral particles
LVP070	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, XPO5, is fully sequence verified and matched to NCBI accession ID: NM_020750.2

Xpo5 ORF Vector (Rat) (pORF)
ORF079216	ABM	1.0 ug DNA	EUR 506

Xpo5 ORF Vector (Mouse) (pORF)
ORF061967	ABM	1.0 ug DNA	EUR 506

XPO5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2650802	ABM	1.0 ug DNA	EUR 154

XPO5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2650803	ABM	1.0 ug DNA	EUR 154

XPO5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2650804	ABM	1.0 ug DNA	EUR 154

XPO5 Protein Vector (Human) (pPB-C-His)
PV046585	ABM	500 ng	EUR 329

XPO5 Protein Vector (Human) (pPB-N-His)
PV046586	ABM	500 ng	EUR 329

XPO5 Protein Vector (Human) (pPM-C-HA)
PV046587	ABM	500 ng	EUR 329

XPO5 Protein Vector (Human) (pPM-C-His)
PV046588	ABM	500 ng	EUR 329

XPO5 Protein Vector (Human) (pPB-C-His)
PV046589	ABM	500 ng	EUR 329

XPO5 Protein Vector (Human) (pPB-N-His)
PV046590	ABM	500 ng	EUR 329

XPO5 Protein Vector (Human) (pPM-C-HA)
PV046591	ABM	500 ng	EUR 329

XPO5 Protein Vector (Human) (pPM-C-His)
PV046592	ABM	500 ng	EUR 329

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Exportin-1 (XPO1) Antibody (HRP)
20-abx316080	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody (FITC)
20-abx316081	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Exportin-1 (XPO1) Antibody (Biotin)
20-abx316082	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-RANBP16 / Exportin 7 antibody
STJ70494	St John's Laboratory	100 µg	EUR 359

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Exportin 1 (XPO1) Polyclonal Antibody (Human, Pig)
4-PAC258Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: XPo1 (Thr917~Asp1071) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Exportin 1 (XPO1)

Human XPO5(Exportin 5) ELISA Kit