Mouse TGM3(Transglutaminase 3, Epidermal) ELISA Kit

Mouse TGM3(Transglutaminase 3, Epidermal) ELISA Kit

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RD-TGM3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RD-TGM3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
DLR-TGM3-Hu-48T	DL Develop	48T	EUR 498
Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
DLR-TGM3-Hu-96T	DL Develop	96T	EUR 647
Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RDR-TGM3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RDR-TGM3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RD-TGM3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
RD-TGM3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit
20-abx154750	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit
4-SEB756Mu	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transglutaminase 3, Epidermal elisa. Alternative names of the recognized antigen: TGE Egt Protein-Glutamine Gamma-Glutamyltransferase E Transglutaminase E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Transglutaminase 3, Epidermal (TGM3) Antibody
20-abx103072	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody
20-abx103073	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody
20-abx004493	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody
abx029604-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody
abx029604-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody
20-abx174895	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Transglutaminase 3, Epidermal (TGM3) Antibody
20-abx178689	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Recombinant Transglutaminase 3, Epidermal (TGM3)
4-RPB756Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q08188 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Transglutaminase 3, Epidermal expressed in: E.coli

Recombinant Transglutaminase 3, Epidermal (TGM3)
4-RPB756Mu01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q08189 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.0kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Transglutaminase 3, Epidermal expressed in: E.coli

Mouse Transglutaminase 3, Epidermal (TGM3) Protein
20-abx069445	Abbexa	EUR 523.00 EUR 244.00 EUR 1497.00 EUR 606.00 EUR 384.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Transglutaminase 3, Epidermal (TGM3) CLIA Kit
20-abx493048	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse TGM3 (Transglutaminase 3, Epidermal)
ELK3994	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 3, Epidermal (TGM3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Transglutaminase 3, Epidermal from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Pig Transglutaminase 3, Epidermal (TGM3) ELISA Kit
abx361096-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Transglutaminase 3, Epidermal (TGM3) ELISA Kit
abx362855-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human TGM3(Transglutaminase 3, Epidermal) ELISA Kit
EH3869	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q08188 Alias: TGM3/TG3/TgaseE/EC 2.3.2.13/MGC126250/protein-glutamine gamma-glutamyltransferase E/TG(E)/TGase E/TGase-3/TGEMGC126249/transglutaminase 3(E polypeptide, protein-glutamine-gamma-glutamyltransfe Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
20-abx153275	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Chicken Transglutaminase 3, Epidermal (TGM3) ELISA Kit
abx355995-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Transglutaminase 3, Epidermal (TGM3) ELISA Kit
abx359247-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
abx253266-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
SEB756Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit
4-SEB756Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transglutaminase 3, Epidermal elisa. Alternative names of the recognized antigen: TGE Egt Protein-Glutamine Gamma-Glutamyltransferase E Transglutaminase E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transglutaminase 3, Epidermal ELISA Kit (TGM3)
RK02382	Abclonal	96 Tests	EUR 521

Human Transglutaminase 3, Epidermal(TGM3)ELISA Kit
QY-E04117	Qayee Biotechnology	96T	EUR 361

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse)
4-PAB756Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3)

Human Transglutaminase 3, Epidermal (TGM3) Protein
20-abx069444	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody (FITC)
20-abx273922	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody (Biotin)
20-abx272183	Abbexa	EUR 439.00 EUR 244.00 EUR 1261.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody (Biotin)
20-abx272888	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Transglutaminase 3, Epidermal (TGM3) CLIA Kit
20-abx493047	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Transglutaminase 3, Epidermal (TGM3) CLIA Kit
abx197835-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Human TGM3 (Transglutaminase 3, Epidermal)
E-EL-H2337	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TGM3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TGM3. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TGM3 (Transglutaminase 3, Epidermal) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human TGM3 (Transglutaminase 3, Epidermal)
ELK2170	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 3, Epidermal (TGM3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Transglutaminase 3, Epidermal from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), APC
4-PAB756Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with APC.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), Biotinylated
4-PAB756Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with Biotin.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), Cy3
4-PAB756Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with Cy3.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), FITC
4-PAB756Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with FITC.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), HRP
4-PAB756Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with HRP.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), PE
4-PAB756Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with PE.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human)
4-PAB756Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3)

CLIA kit for Human TGM3 (Transglutaminase 3, Epidermal)
E-CL-H1365	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's TGM3 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human TGM3 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human TGM3 (Transglutaminase 3, Epidermal) in samples from Serum, Plasma, Cell supernatant

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB756Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with APC-Cy7.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), APC
4-PAB756Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with APC.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), Biotinylated
4-PAB756Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with Biotin.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), Cy3
4-PAB756Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with Cy3.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), FITC
4-PAB756Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with FITC.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), HRP
4-PAB756Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with HRP.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), PE
4-PAB756Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with PE.

Transglutaminase 3 (TGM3) Antibody
abx433398-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), APC-Cy7
4-PAB756Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TGM3 (Ala468~Glu693) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with APC-Cy7.

Tgm3/ Rat Tgm3 ELISA Kit
ELI-52085r	Lifescience Market	96 Tests	EUR 886

Mouse Tgm3 ELISA KIT
ELI-29290m	Lifescience Market	96 Tests	EUR 865

TGM3 ELISA Kit (Mouse) (OKCD00845)
OKCD00845	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Catalyzes the calcium-dependent formation of isopeptide cross-links between glutamine and lysine residues in various proteins, as well as the conjugation of polyamines to proteins. Involved in the formation of the cornified envelope (CE), a specialized component consisting of covalent cross-links of proteins beneath the plasma membrane of terminally differentiated keratinocytes. Catalyzes small proline-rich proteins (SPRR1 and SPRR2) and LOR cross-linking to form small interchain oligomers, which are further cross-linked by TGM1 onto the growing CE scaffold (By similarity). In hair follicles, involved in cross-linking structural proteins to hardening the inner root sheath.By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.138 ng/mL

EGF Mouse, Epidermal Growth Factor Mouse Recombinant Protein, Biotin
PROTP01132-3	BosterBio	Regular: 10ug	EUR 317
Description: EGF Mouse Recombinant, Biotin produced in E.Coli is a non-glycosylated polypeptide chain containing 61 amino acids and having a total molecular mass of 7.0kDa. This version of EGF has a N terminal leader sequence hosting a biotin conjugation. There are 0.5 biotins for each EGF protein.

Mouse Transglutaminase ELISA kit
E03T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transglutaminase ELISA kit
E03T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transglutaminase ELISA kit
E03T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine TGM3 ELISA KIT
ELI-19015b	Lifescience Market	96 Tests	EUR 928

Human TGM3 ELISA KIT
ELI-17237h	Lifescience Market	96 Tests	EUR 824

TGM3 ELISA KIT|Human
EF007210	Lifescience Market	96 Tests	EUR 689

Mouse Tissue Transglutaminase ELISA kit
E03T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tissue Transglutaminase ELISA kit
E03T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tissue Transglutaminase ELISA kit
E03T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TGM3 ELISA Kit (Human) (OKCD01600)
OKCD01600	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Catalyzes the calcium-dependent formation of isopeptide cross-links between glutamine and lysine residues in various proteins, as well as the conjugation of polyamines to proteins. Involved in the formation of the cornified envelope (CE), a specialized component consisting of covalent cross-links of proteins beneath the plasma membrane of terminally differentiated keratinocytes. Catalyzes small proline-rich proteins (SPRR1 and SPRR2) and LOR cross-linking to form small interchain oligomers, which are further cross-linked by TGM1 onto the growing CE scaffold. In hair follicles, involved in cross-linking structural proteins to hardening the inner root sheath.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

Mouse Transglutaminase 2,Tissue ELISA kit
E03T0764-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transglutaminase 2,Tissue ELISA kit
E03T0764-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transglutaminase 2,Tissue ELISA kit
E03T0764-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transglutaminase 2,Tissue in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transglutaminase 6 (TGM6) ELISA Kit
20-abx156968	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Transglutaminase 6 (TGM6) ELISA Kit
SEH033Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 6 (TGM6) ELISA Kit
SEH033Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 6 (TGM6) ELISA Kit
SEH033Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 6 (TGM6) ELISA Kit
SEH033Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 6 (TGM6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 6 (TGM6) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 6 (TGM6) ELISA Kit
4-SEH033Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transglutaminase 6 elisa. Alternative names of the recognized antigen: TGM3L TGY SCA35 Transglutaminase 3-Like Spinocerebellar Ataxia 35 Transglutaminase Y Protein-glutamine gamma-glutamyltransferase 6
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Transglutaminase 6 (TGM6) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse TGM3 shRNA Plasmid
20-abx973096	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TGM3 Recombinant Protein (Mouse)
RP178490	ABM	100 ug	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Rat Transglutaminase ELISA kit
E02T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transglutaminase ELISA kit
E02T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transglutaminase ELISA kit
E02T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transglutaminase ELISA kit
E04T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transglutaminase ELISA kit
E04T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transglutaminase ELISA kit
E04T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transglutaminase ELISA kit
E01T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transglutaminase ELISA kit
E01T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transglutaminase ELISA kit
E01T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transglutaminase ELISA kit
E06T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transglutaminase ELISA kit
E06T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transglutaminase ELISA kit
E06T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transglutaminase ELISA kit
E08T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transglutaminase ELISA kit
E08T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transglutaminase ELISA kit
E08T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transglutaminase ELISA kit
E07T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transglutaminase ELISA kit
E07T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transglutaminase ELISA kit
E07T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transglutaminase ELISA kit
E09T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transglutaminase ELISA kit
E09T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transglutaminase ELISA kit
E09T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TGM3 siRNA
20-abx905550	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGM3 siRNA
20-abx936641	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGM3 siRNA
20-abx936642	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGM3 Antibody
33094-100ul	SAB	100ul	EUR 252

Tgm3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3930004	ABM	1.0 ug DNA	EUR 154

Transglutaminase 3 antibody
70R-3925	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Transglutaminase 3 antibody

Mouse Tissue Transglutaminase / TG2 (TGM2) ELISA Kit
abx518363-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Anti tissue transglutaminase lgA ELISA kit
E03T0550-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anti tissue transglutaminase lgA ELISA kit
E03T0550-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anti tissue transglutaminase lgA ELISA kit
E03T0550-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Anti tissue transglutaminase lgA in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse TGM6 (Transglutaminase 6)
ELK7329	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 6 (TGM6). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transglu Show more
Description: A sandwich ELISA kit for detection of Transglutaminase 6 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
20-abx154749	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
DLR-TGM1-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transglutaminase 1, Keratinocyte (TGM1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
DLR-TGM1-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transglutaminase 1, Keratinocyte (TGM1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Transglutaminase 2, Tissue (TGM2) ELISA Kit
DLR-TGM2-Mu-48T	DL Develop	48T	EUR 508
Should the Mouse Transglutaminase 2, Tissue (TGM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Transglutaminase 2, Tissue (TGM2) ELISA Kit
DLR-TGM2-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Transglutaminase 2, Tissue (TGM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transglutaminase 2, Tissue (TGM2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 1, Keratinocyte (TGM1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 1, Keratinocyte (TGM1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 1, Keratinocyte (TGM1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
SEB773Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 1, Keratinocyte (TGM1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Ass Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 1, Keratinocyte (TGM1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
4-SEB773Mu	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transglutaminase 1, Keratinocyte elisa. Alternative names of the recognized antigen: TGK ICR2 KTG LI LI1 TGASE Transglutaminase K K Polypeptide Epidermal Type I Protein-Glutamine-Gamma-Glutamyltransferase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Transglutaminase 1, Keratinocyte (TGM1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RDR-TGM1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RDR-TGM1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Mouse Transglutaminase 2, Tissue (TGM2) ELISA Kit
RDR-TGM2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Transglutaminase 2, Tissue (TGM2) ELISA Kit
RDR-TGM2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RD-TGM1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Transglutaminase 1, Keratinocyte (TGM1) ELISA Kit
RD-TGM1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Mouse Transglutaminase 2, Tissue (TGM2) ELISA Kit
RD-TGM2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Transglutaminase 2, Tissue (TGM2) ELISA Kit
RD-TGM2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Mouse Transglutaminase 2, Tissue(TGM2)ELISA Kit
QY-E21504	Qayee Biotechnology	96T	EUR 361

Tgm3 ORF Vector (Mouse) (pORF)
ORF059498	ABM	1.0 ug DNA	EUR 506

Transglutaminase 2 Cell ELISA Kit
abx595602-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Guinea pig Transglutaminase ELISA kit
E05T0035-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transglutaminase ELISA kit
E05T0035-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transglutaminase ELISA kit
E05T0035-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tissue Transglutaminase ELISA kit
E01T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tissue Transglutaminase ELISA kit
E01T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tissue Transglutaminase ELISA kit
E01T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tissue Transglutaminase ELISA kit
E02T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tissue Transglutaminase ELISA kit
E02T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tissue Transglutaminase ELISA kit
E02T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tissue Transglutaminase ELISA kit
E04T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tissue Transglutaminase ELISA kit
E04T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tissue Transglutaminase ELISA kit
E04T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tissue Transglutaminase ELISA kit
E08T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tissue Transglutaminase ELISA kit
E08T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tissue Transglutaminase ELISA kit
E08T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tissue Transglutaminase ELISA kit
E07T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tissue Transglutaminase ELISA kit
E07T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tissue Transglutaminase ELISA kit
E07T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tissue Transglutaminase ELISA kit
E06T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tissue Transglutaminase ELISA kit
E06T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tissue Transglutaminase ELISA kit
E06T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tissue Transglutaminase ELISA kit
E09T0766-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tissue Transglutaminase ELISA kit
E09T0766-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tissue Transglutaminase ELISA kit
E09T0766-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tissue Transglutaminase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Transglutaminase Antibody IgG ELISA Kit
DEIA1861	Creative Diagnostics	96T	EUR 814
Description: The Transglutaminase Antibody IgG ELISA Kit is an indirect solid phase enzyme immunoassay (ELISA) for measurement of IgG class autoantibodies against tissue Transglutaminase (tTG) in human serum or plasma.

Anti-Tissue Transglutaminase ELISA Kit
DEIA1970	Creative Diagnostics	96T	EUR 814
Description: Anti-Tissue-Transglutaminase is an indirect solid phase enzyme immunoassay (ELISA) for the simultaneous measurement of IgG and IgA class autoantibodies to tissue transglutaminase (tTG) in human serum or plasma.

Mouse Epidermal membrane antigen ELISA kit
E03E0136-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Epidermal membrane antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal membrane antigen ELISA kit
E03E0136-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Epidermal membrane antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal membrane antigen ELISA kit
E03E0136-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Epidermal membrane antigen in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TGM3 Conjugated Antibody
C33094	SAB	100ul	EUR 397

TGM3 cloning plasmid
CSB-CL600462HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2082 Sequence: ATGGCTGCTCTAGGAGTCCAGAGTATCAACTGGCAGACGGCCTTCAACCGACAAGCGCATCACACAGACAAGTTCTCCAGCCAGGAGCTCATCTTGCGGAGAGGCCAAAACTTCCAGGTCTTAATGATCATGAACAAAGGCCTTGGCTCTAACGAAAGACTGGAGTTCATTGTCT Show more
Description: A cloning plasmid for the TGM3 gene.

TGM3 Polyclonal Antibody
ES11868-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TGM3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TGM3 Polyclonal Antibody
ES11868-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TGM3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TGM3 Polyclonal Antibody
ABP60669-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human TGM3 protein Applications tips:
Description: A polyclonal antibody for detection of TGM3 from Human. This TGM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM3 protein

TGM3 Polyclonal Antibody
ABP60669-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human TGM3 protein Applications tips:
Description: A polyclonal antibody for detection of TGM3 from Human. This TGM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM3 protein

TGM3 Polyclonal Antibody
ABP60669-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human TGM3 protein Applications tips:
Description: A polyclonal antibody for detection of TGM3 from Human. This TGM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM3 protein

TGM3 Rabbit pAb
A5856-100ul	Abclonal	100 ul	EUR 308

TGM3 Rabbit pAb
A5856-200ul	Abclonal	200 ul	EUR 459

TGM3 Rabbit pAb
A5856-20ul	Abclonal	20 ul	EUR 183

TGM3 Rabbit pAb
A5856-50ul	Abclonal	50 ul	EUR 223

Anti-TGM3 antibody
STJ28419	St John's Laboratory	100 µl	EUR 277
Description: Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle.

Anti-TGM3 antibody
STJ193026	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TGM3

Transglutaminase 3 Blocking Peptide
33R-5600	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TGM3 antibody, catalog no. 70R-3925

ELISA kit for Mouse TGM1 (Transglutaminase 1, Keratinocyte)
ELK3995	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transglutaminase 1, Keratinocyte (TGM1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specif Show more
Description: A sandwich ELISA kit for detection of Transglutaminase 1, Keratinocyte from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse TGM2 (Transglutaminase 2, Tissue)
E-EL-M1195	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TGM2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse TGM2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse TGM2 (Transglutaminase 2, Tissue) in samples from Serum, Plasma, Cell supernatant

Mouse Transglutaminase 6 (TGM6) CLIA Kit
20-abx495360	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Tgm3 sgRNA CRISPR Lentivector set (Mouse)
K3930001	ABM	3 x 1.0 ug	EUR 339

Mouse Total Epidermal Growth Factor ELISA kit
E03E0032-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Epidermal Growth Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Epidermal Growth Factor ELISA kit
E03E0032-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Epidermal Growth Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Total Epidermal Growth Factor ELISA kit
E03E0032-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Total Epidermal Growth Factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0121-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0121-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0121-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0123-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0123-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal basement membrane zone ELISA kit
E03E0123-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal basement membrane zone in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal growth factor receptor ELISA kit
E03E0129-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal growth factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal growth factor receptor ELISA kit
E03E0129-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal growth factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal growth factor receptor ELISA kit
E03E0129-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Epidermal growth factor receptor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Epidermal growth factor, EGF ELISA Kit
ELA-E0560m	Lifescience Market	96 Tests	EUR 865

Mouse Epidermal growth factor(EGF)ELISA Kit
GA-E0714MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Epidermal growth factor(EGF)ELISA Kit
GA-E0714MS-96T	GenAsia Biotech	96T	EUR 534

Mouse EGF(Epidermal growth factor) ELISA Kit
EM0007	FN Test	96T	EUR 476.25
Detection range: 15.6-1000 pg/ml Uniprot ID: P01132 Alias: EGF(Epidermal growth factor)/URG/HOMG4/Beta-Urogastrone
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Mouse Epidermal Growth Factor (EGF) ELISA Kit
20-abx153939	Abbexa	EUR 5640.00 EUR 3009.00 EUR 707.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Epidermal Growth Factor (EGF) ELISA Kit
abx253960-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Mouse Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-Mu-48T	DL Develop	48T	EUR 315
Should the Mouse Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Epidermal Growth Factor (EGF) ELISA Kit
DLR-EGF-Mu-96T	DL Develop	96T	EUR 396
Should the Mouse Epidermal Growth Factor (EGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Epidermal Growth Factor (EGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Epidermal Growth Factor, Egf ELISA Kit
DEIA098	Creative Diagnostics	15 Plates	EUR 2408
Description: Mouse EGF ELISA development kit contains the key components required for the quantitative measurement of natural and/or recombinant EGF in a sandwich ELISA format within the range of 16-1,000 pg/mL. Using the ELISA protocol described below, this kit provides sufficient reagent to assay EGF in approximately 1,500 ELISA plate wells.

Mouse TGM3(Transglutaminase 3, Epidermal) ELISA Kit