Zfp57 inactivation illustrates the role of ICR methylation in imprinted gene expression during neural differentiation of mouse ESCs

Copper deficiency (CuD) is a typical trigger of oxidative cardiac tissue harm in ruminants. The expression of copper chaperone (Cu-Ch) encoding genes permits an in-depth understanding of copper-associated problems, however no earlier research have been undertaken to spotlight Cu-Ch disturbances in coronary heart tissue in ruminants as a result of CuD. The present research aimed to research the Cu-Ch mRNA expression in the coronary heart of goats after experimental CuD and spotlight their relationship with the cardiac measurements.

Eleven male goats had been enrolled in this research and divided into the management group (n = 4) and CuD group (n = 7), which obtained copper-reducing dietary regimes for 7 months. Heart operate was evaluated by electrocardiography and echocardiography, and at the finish of the experiment, all animals had been sacrificed and the cardiac tissues had been collected for histopathology and quantitative mRNA expression by real-time PCR.

In the therapy group, cardiac measurements revealed elevated preload and the existence of cardiac dilatation, and vital cardiac tissue harm by histopathology. Also, the relative mRNA expression of Cu-Ch encoding genes; ATP7A, CTr1, LOX, COX17, in addition to ceruloplasmin (CP), troponin I3 (TNNI3), glutathione peroxidase (GPX1), and matrix metalloprotease inhibitor (MMPI1) genes had been considerably down-regulated in CuD group.

There was a major correlation between investigated genes and a few cardiac operate measurements; in the meantime, a major inverse correlation was noticed between histopathological rating and ATP7B, CTr1, LOX, and COX17. In conclusion, this research revealed that CuD induces cardiac dilatation and alters the mRNA expression of Cu-Ch genes, in addition to TNNI3, GPX1, and MMPI1 which are thought of key components in clinically undetectable CuD-induced cardiac harm in goats which necessitate additional research for feasibility as biomarkers.

Crassulacean acid metabolism (CAM) is a vital photosynthetic pathway for plant adaptation to dry environments. CAM crops characteristic a coordinated interplay between mesophyll and dermis features that includes refined laws of gene expression. Plant microRNAs (miRNAs) are essential post-transcription regulators of gene expression, nonetheless, their roles underlying the CAM pathway stay poorly investigated. Here, we current a research characterizing the expression of miRNAs in an obligate CAM species Kalanchoë marnieriana.

Through sequencing of transcriptome and degradome in mesophyll and epidermal tissues underneath the drought remedies, we recognized differentially expressed miRNAs that had been probably concerned in the regulation of CAM. In whole, we obtained 84 miRNA genes, and eight of them had been decided to be Kalanchoë-specific miRNAs. It is broadly accepted that CAM pathway is regulated by circadian clock.

We confirmed that miR530 was considerably downregulated in epidermal peels underneath drought situations; miR530 focused two tandem zinc knuckle/PLU3 area encoding genes (TZPs) that had been probably concerned in mild signaling and circadian clock pathways. Our work means that the miR530-TZPs module would possibly play a role of regulating CAM-related gene expression in Kalanchoë.

Senescence is the ultimate stage of leaf growth and is important for crops’ health as nutrient relocation from leaves to reproductive organs takes place. Although senescence is vital in nutrient relocation and yield dedication in cereal grain manufacturing, there may be restricted understanding of the genetic and molecular mechanisms that management it in main staple crops equivalent to wheat. Senescence is a extremely orchestrated continuum of interacting pathways all through the lifecycle of a plant. Levels of gene expression, morphogenesis, and phenotypic growth all play key roles.

Yet, most research give attention to a brief window instantly after anthesis. This strategy clearly leaves out key elements controlling the activation, growth, and modulation of the senescence pathway earlier than anthesis, in addition to during the later developmental phases, during which grain growth continues. Here, a computational multiscale modelling strategy integrates multi-omics developmental knowledge to try to simulate senescence at the molecular and plant stage.

To recreate the senescence course of in wheat, core rules had been borrowed from Arabidopsis Thaliana, a extra broadly researched plant mannequin. The resulted mannequin describes temporal gene regulatory networks and their impact on plant morphology resulting in senescence. Digital phenotypes generated from photos utilizing a phenomics platform had been used to seize the dynamics of plant growth.

Human Bone Morphogenetic Protein 3 (BMP3) ELISA Kit
RD-BMP3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Bone Morphogenetic Protein 3 (BMP3) ELISA Kit
RD-BMP3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Bmp3/ Rat Bmp3 ELISA Kit
ELI-11930r	Lifescience Market	96 Tests	EUR 886

HEK-293T Telomerase Over-Expressing Cell Pellet
abx069991-1Pellet	Abbexa	1 Pellet	EUR 398
Shipped within 1-3 working days.

BMP3 protein
30R-2364	Fitzgerald	50 ug	EUR 336
Description: Purified recombinant Human BMP3 protein

BMP3 antibody
70R-12376	Fitzgerald	100 ug	EUR 436
Description: Rabbit polyclonal BMP3 antibody

BMP3 antibody
70R-12406	Fitzgerald	100 ug	EUR 447
Description: Goat polyclonal BMP3 antibody

BMP3 antibody
70R-12407	Fitzgerald	100 ug	EUR 436
Description: Rabbit polyclonal BMP3 antibody

BMP3 Antibody
34500-100ul	SAB	100ul	EUR 252

BMP3 Antibody
34500-50ul	SAB	50ul	EUR 187

BMP3 Antibody
35653-100ul	SAB	100ul	EUR 252

BMP3 Antibody
1-CSB-PA005413	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

BMP3 Antibody
1-CSB-PA001003	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

BMP3 Antibody
1-CSB-PA001013	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

BMP3 Antibody
1-CSB-PA002739LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

BMP3 Antibody
CSB-PA105888-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

BMP3 Antibody
CSB-PA105888-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

BMP3 Antibody
1-CSB-PA930762	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

BMP3 Antibody
1-CSB-PA901137	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

BMP3 Antibody
DF3848	Affbiotech	200ul	EUR 304
Description: BMP3 Antibody detects endogenous levels of total BMP3.

BMP3 Antibody
1-CSB-PA192641	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

BMP3 antibody
70R-35783	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal BMP3 antibody

BMP3 antibody
70R-49417	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal BMP3 antibody

BMP3 Antibody
AF5153	Affbiotech	200ul	EUR 304
Description: BMP3 Antibody detects endogenous levels of total BMP3.

BMP3 siRNA
20-abx900650	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BMP3 siRNA
20-abx909172	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BMP3 siRNA
20-abx909173	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BMP3 Antibody
ABD3848	Lifescience Market	100 ug	EUR 438

BMP3 Antibody
ABF5153	Lifescience Market	100 ug	EUR 438

anti-BMP3
YF-PA10496	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to BMP3

anti-BMP3
YF-PA23307	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to BMP3

Chymase reagent
30C-CP1129	Fitzgerald	5 units	EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent
2330-1000	Biovision		EUR 349

Traut's Reagent
2330-500	Biovision		EUR 207

MTS Reagent
2808-1000	Biovision		EUR 990

MTS Reagent
2808-250	Biovision		EUR 365

MTT Reagent
2809-1G	Biovision		EUR 180

MTT Reagent
2809-5G	Biovision		EUR 544

BOP reagent
5-02141	CHI Scientific	25g	Ask for price

BOP reagent
5-02142	CHI Scientific	100g	Ask for price

Bluing Reagent
BRT030	ScyTek Laboratories	30 ml	EUR 60

Bluing Reagent
BRT125	ScyTek Laboratories	125 ml	EUR 63

Bluing Reagent
BRT3800	ScyTek Laboratories	1 Gal.	EUR 184

Bluing Reagent
BRT500	ScyTek Laboratories	500 ml	EUR 76

Bluing Reagent
BRT999	ScyTek Laboratories	1000 ml	EUR 88

BOP reagent
A7015-100000	ApexBio	100 g	EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent
A7015-25000	ApexBio	25 g	EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent
HY-100951	MedChemExpress	10mM/1mL	EUR 126

Bradford reagent
BDE641	Bio Basic	100ml	EUR 61.01
Product category: Biochemicals/Biology Reagents/Protein Related

BMP3 Blocking Peptide
33R-11055	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BMP3 antibody, catalog no. 70R-12407

BMP3 Blocking Peptide
DF3848-BP	Affbiotech	1mg	EUR 195

BMP3 Blocking Peptide
20-abx062292	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

BMP3 Blocking Peptide
AF5153-BP	Affbiotech	1mg	EUR 195

BMP3 Conjugated Antibody
C35653	SAB	100ul	EUR 397

BMP3 cloning plasmid
CSB-CL002739HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1419 Sequence: ATGGCTGGGGCGAGCAGGCTGCTCTTTCTGTGGCTGGGCTGCTTCTGCGTGAGCCTGGCGCAGGGAGAGAGACCGAAGCCACCTTTCCCGGAGCTCCGCAAAGCTGTGCCAGGTGACCGCACGGCAGGTGGTGGCCCGGACTCCGAGCTGCAGCCGCAAGACAAGGTCTCTGAAC Show more
Description: A cloning plasmid for the BMP3 gene.

BMP3 Rabbit pAb
A6877-100ul	Abclonal	100 ul	EUR 308

BMP3 Rabbit pAb
A6877-200ul	Abclonal	200 ul	EUR 459

BMP3 Rabbit pAb
A6877-20ul	Abclonal	20 ul	EUR 183

BMP3 Rabbit pAb
A6877-50ul	Abclonal	50 ul	EUR 223

BMP3 Polyclonal Antibody
A52753	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

anti- BMP3 antibody
FNab00918	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:100 - 1:200 Immunogen: bone morphogenetic protein 3 Uniprot ID: P12645 Gene ID: 651 Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against BMP3

Anti-BMP3 antibody
PAab00918	Lifescience Market	100 ug	EUR 355

Anti-BMP3 antibody
STJ28957	St John's Laboratory	100 µl	EUR 277
Description: BMP3 belongs to the transforming growth factor-beta (TGFB) superfamily. Bone morphogenic protein, also known as osteogenin, induces bone formation.

Anti-BMP3 antibody
STJ71562	St John's Laboratory	100 µg	EUR 260

Arabidopsis Thaliana Lysate
30R-AA023	Fitzgerald	150 ug	EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate
35-1867	Fitzgerald	1 mg	EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate
35-1872	Fitzgerald	1 ml	EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate
35-1873	Fitzgerald	1 ml	EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody
abx234439-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

BL21-lysate Antibody
abx230905-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DH5a-lysate Antibody
abx232362-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Green Algae Lysate
PABL-1306	Alpha Diagnostics	50 ug	EUR 164

BSA (Reagent Grade)
30-AB79	Fitzgerald	1 kg	EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)
30-AB81	Fitzgerald	200 grams	EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit
30100	Biotium	1KIT	EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent
2594-1	Biovision		EUR 207

BODIPY-Acetylene Reagent
2594-5	Biovision		EUR 675

Biotin reagent (HRP)
65C-CE0202	Fitzgerald	5 mg	EUR 244
Description: HRP conjugated biotin labelling reagent

Convoy? Transfection Reagent
1110-1ml	ACTGene		EUR 341

Bradford Dye Reagent
0209R	AthenaES	100 ml	EUR 131

HAMA blocking reagent
85R-1001	Fitzgerald	1 gram	EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent
85R-1001P	Fitzgerald	1 gram	EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent
85R-1003	Fitzgerald	1 gram	EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent
85R-1014	Fitzgerald	50 mg	EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent
85R-1025	Fitzgerald	50 mg	EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent
85R-1026	Fitzgerald	50 mg	EUR 192
Description: HAMA blocking reagent for use in immunoassays

Girard's reagent T
20-abx184099	Abbexa	EUR 203.00 EUR 314.00	100 g 500 g
Shipped within 1-2 weeks.

EL Transfection Reagent
20-abx098880	Abbexa	EUR 384.00 EUR 537.00	0.75 ml 1.5 ml
Shipped within 5-10 working days.

Mycoplasma Prevention Reagent
20-abx098886	Abbexa	EUR 425.00 EUR 509.00	1 ml 5 ml
Shipped within 5-10 working days.

Alcohol, Reagent (70%)
EAS500	ScyTek Laboratories	500 ml	EUR 79

Alcohol, Reagent (70%)
EAS999	ScyTek Laboratories	1000 ml	EUR 101

BCA Reagent, 16ML
C144-16ML	Arbor Assays	16ML	EUR 163

Biolipidure-1002-Reagent
Biolipidure-1002-10	Cusabio	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent
Biolipidure-1002-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent
Biolipidure-103-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent
Biolipidure-103-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent
Biolipidure-1201-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent
Biolipidure-1201-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent
Biolipidure-1301-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent
Biolipidure-1301-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent
Biolipidure-203-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent
Biolipidure-203-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent
Biolipidure-206-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent
Biolipidure-206-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent
Biolipidure-405-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent
Biolipidure-405-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent
Biolipidure-502-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent
Biolipidure-502-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent
Biolipidure-702-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent
Biolipidure-702-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent
Biolipidure-802-10	Biolipidure	10mL	EUR 196
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent
Biolipidure-802-100	Biolipidure	100mL	EUR 1223
Biolipidure enhances sensitivity and accuracy. Biolipidure suppresses non-specific adsorption. Biolipidure stabilizes antibodies and enzymes. Biolipidure eliminates lot-to-lot variations. Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

FcR blocking Reagent
20-abx290024	Abbexa	EUR 377.00 EUR 516.00	200 tests 400 tests
Shipped within 2-3 weeks.

Detection Reagent A
abx296004-120ul	Abbexa	120 ul	EUR 321
Shipped within 5-10 working days.

Mycoplasma Prevention Reagent
20-abx298005	Abbexa	EUR 203.00 EUR 286.00	1 ml 5 ml
Shipped within 5-10 working days.

PhosphoBlocker Blocking Reagent
AKR-103	Cell Biolabs	1L	EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent
AKR-104	Cell Biolabs	4L	EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Tri-RNA Reagent
FATRR-001	Favorgen	100ml	EUR 236

Tri-RNA Reagent
FATRR-002	Favorgen	50ml	EUR 176

Tri-RNA Reagent
FATRR-003	Favorgen	450ml	EUR 645

LP4K Transfection Reagent
LP4K	GenTarget	1.0 ml / vial	EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

PureFection Transfection Reagent
LV750A-1	SBI	1 ml	EUR 359
Category: Lentiviral Technology

HighGene transfection reagent
RM09014	Abclonal	1000μl	EUR 270

TissueDigest Reagent, 20X
T101	Insitus Biotechnologies	10ml	EUR 210

ExFect2000 Transfection Reagent
T202-01	Vazyme	0.5 ml	EUR 227

ExFect2000 Transfection Reagent
T202-02	Vazyme	1 ml	EUR 316

ExFect2000 Transfection Reagent
T202-03	Vazyme	5 ml	EUR 1052

Dissociation Reagent, 1ML
X017-1ML	Arbor Assays	1ML	EUR 109

Dissociation Reagent, 25ML
X017-25ML	Arbor Assays	25ML	EUR 258

Dissociation Reagent, 5ML
X017-5ML	Arbor Assays	5ML	EUR 122

Dissociation Reagent, 1ML
X058-1ML	Arbor Assays	1ML	EUR 73

Dissociation Reagent, 5ML
X058-5ML	Arbor Assays	5ML	EUR 109

DTT (Cleland's reagent)
DB0058	Bio Basic	5g	EUR 84.8
Product category: Electrophoresis Related/Reducing Agents

DTNB (Ellman's Reagent)
DB0113	Bio Basic	5g	EUR 97.85
Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Ethyl acetate Reagent
EC4600	Bio Basic	1L	EUR 79
Product category: Biochemicals/Solvents

n-Heptane Reagent
HC5400	Bio Basic	1L	EUR 79
Product category: Biochemicals/Solvents

BMP3 Antibody, HRP conjugated
1-CSB-PA002739LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BMP3 Antibody, FITC conjugated
1-CSB-PA002739LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BMP3 Antibody, Biotin conjugated
1-CSB-PA002739LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMP3. Recognizes BMP3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat BMP3 shRNA Plasmid
20-abx985208	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse BMP3 shRNA Plasmid
20-abx980044	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human BMP3 shRNA Plasmid
20-abx950446	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

BMP3 Recombinant Protein (Human)
RP037009	ABM	100 ug	Ask for price

BMP3 Recombinant Protein (Rat)
RP192266	ABM	100 ug	Ask for price

This work offers the foundation for the utility of computational modelling to advance understanding of the advanced organic trait senescence. This helps the growth of a predictive framework enabling its prediction in altering or excessive environmental situations, with a view to focused choice for optimum lifecycle period for bettering resilience to local weather change.